BME100 s2015:Group13 12pmL5

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png BME 100 Spring 2015 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png


OUR TEAM

Name: Tina Monteilh
Name: Payson Wallach
Name: Riley Baranek
Name: Trisha Dasgupta
Name: Robel Okbe


LAB 5 WRITE-UP

Procedure

Smart Phone Camera Settings

  • Type of Smartphone: Iphone 6
    • Flash: no flash used
    • ISO setting:was not adjusted
    • White Balance: was not adjusted
    • Exposure: time: 1/15 of a second
    • Saturation:was not adjusted
    • Contrast: highest contrast available


Calibration
The camera (iPhone 6) was set up horizontally in front of the fluorimeter, and was placed in the cradle after the camera was adjusted according to the settings listed above. After adjustment, the image was checked to make sure that it was not blurry. The fluorimeter was raised up using one stack, in order to make sure the camera captured the best image possible, and the phone was placed 6.5 cm away from the fluorimeter.

  • Distance between the smart phone cradle and drop = 6.5 cm


Solutions Used for Calibration

Initial Concentration of 2X
Calf Thymus DNA solution
(micrograms/mL)
Volume of the 2X
DNA solution (μL)
Volume of the SYBR GREEN I
Dye solution (μL)
Final DNA concentration in SYBR GREEN I solution (μL/mL)
5 80 80 2.5
2 80 80 1
1 80 80 0.5
0.5 80 80 0.25
0.25 80 80 0.125
0 80 80 0



Placing Samples onto the Fluorimeter

  1. Using the mircopipette, place 80μL of the SYBR GREEN I onto the slide in between the first two rows, then add 80μL of of one of the concentrations of calf thymus from the table on top
    of the first drop of SYBR GREEN I so that one large drop is formed
  2. Make sure the drop is alighned so that the blue LED light is shining through the large drop
  3. Set the timer on the camera being used, and place the cover on the lightbox to make sure that the picture is taken with little to no light shining through
    Make sure to take 3 focused images of the drop
  4. Set the micropipette to 160μL and remove the large drop from the slide, before moving the slide to the next position
  5. Repeat steps 1-4 for the rest of the concentrations from the table


Data Analysis

Representative Images of Negative and Positive Samples

Name: Green channel image of a negative sample.



Name: Green channel image of a positive sample.

Image J Values for All Calibrator Samples

Final [DNA] in SYBR Green I Sol (ug/mL) Area Mean Pixel Value RAWINTDEN of Drop RAWINTDEN of Background RAWINTDEN Drop - Background
2.5-1 35996 199.129 7167852 166312 7001540
2.5-2 40180 211.856 8512366 192104 8320262
2.5-3 41729 209.272 8732706 181855 8550851
0.25 0
0.125 0
0 0
.25-3 41590 159.203 6621241 153802 6467439
.25-2 44992 167.481 7535322 22468 7512854
.125-1 40608 108.934 4423611 150574 4273037
.125-2 40608 116.099 4714549 19321 4695228
.125-3 40608 117.204 4759405 18356 4741049
0-1 35264 75.15 2650074 20400 2629674
0-2 34046 84.366 2872310 30032 2842278
0-3 33419 75.27 2515459 26496 2488963
1.1.1 38296 163.748 6270880 101101 6169779
1.1.2 35684 167.31 5970273 138573 5831700
1.1.2 37744 165.82 6258723 237252 6021471
1.2.1 38020 99.863 3796414 107865 3688549
1.2.2 39654 161.47 6402917 269273 6133644
1.2.3 37690 160.225 6038873 109392 5929481
1.3.1 37428 109.65 4103977 281660 3822317
1.3.2 37125 114.666 4256964 114561 4142403
1.3.3 38202 112.909 4314456 149338 4165118
2.1.1 39281 86.217 3386690 149338 3237352
2.1.2 39281 92.082 3617063 188645 3428418
2.1.3 39281 138.829 5453353 21303 5432050
2.2.1 37798 83.975 3174087 151874 3022213
2.2.2 37919 132.678 5031028 54170 4976858
2.2.2 37519 119.076 4467604 138921 4328683
2.3.1 36114 99.117 3579523 175287 3404236
2.3.2 40432 107.872 4361494 34774 4326720
2.3.3 44097 159.975 7183976 183930 7000046
N-1 40338 94.068 3794510 173768 3620742
N-2 47908 199.848 9574297 219253 9354774
N-3 48908 201.997 9715635 209413 9506222
P-1 51537 209.389 10791274 15784 10775490
P-2 40284 118.864 4788337 148864 4639473
P-3 42216 128.918 5442418 16555 5425863
Calibration curve
Name: Calibration Curve


PCR Results Summary

  • Our positive control PCR result was 1.206 μg/mL
  • Our negative control PCR result was 5.791 μg/mL

Observed results

  • Patient 21533: The ImageJ green analysis showed a light grey/white streak through the center of the drop, meaning DNA was present, giving a positive result.
  • Patient 45821 : The ImageJ analysis had no light spot, and matched the calibration test with no DNA, making this patient negative

Conclusions

  • Patient 21533 : Since the ImageJ green analysis contained the light grey/white streak in the center, DNA was present, so it matched the positive control.
  • Patient 45821 : There was no light spot on the Image J analysis for this patient, so it matched the negative control sample.




SNP Information & Primer Design

Background: About the Disease SNP

What is a nucleotide? The organic base units of DNA and RNA What is a polymorphism? A point mutation that is expressed in multiple forms within a population. What species is this variation found in? (latin name) Homo Sapien What chromosome is the variation located on? 8 What is listed as the Clinical significance of this SNP? It is contained within a pathogenic allele Which gene(s) is this SNP associated with? LPL Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? Coronary heart disease What does LPL stand for? Lipoprotein Lipase What is the function of LPL? To find out, click the LPL link. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see... apolipoprotein binding heparin binding lipoprotein lipase activity What is an allele? A variation in a gene The disease-associated allele contains what sequence? aat The numerical position of the SNP is 19956018 Non-disease forward primer (20 nt): aatctgggctatgagatcaa The numerical position exactly 200 bases to the right of the disease SNP is: 19956218 Non-disease reverse primer (20 nt): gaaacaccagggctcagggt Disease forward primer (20 nt): aatctgggctatgagatcag Disease reverse primer (20 nt): gaaacaccagggctcagggt Primer Design and Testing