DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or
samples will be cross-contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G13 +
Positive control
none
G13 -
Negative control
none
G13 1-1
Patient 1, replicate 1
21533
G13 1-2
Patient 1, replicate 2
21533
G13 1-3
Patient 1, replicate 3
21533
G13 2-1
Patient 2, replicate 1
45821
G13 2-2
Patient 2, replicate 2
45821
G13 2-3
Patient 2, replicate 3
45821
DNA Sample Set-up Procedure
Collect all needed Materials
Label the sides of the PCR tubes with the Tube labels listed above.
Place tubes in rack
Micropipette 50 microliters of the positive control mix into the empty tube labelled positive control
Repeat step 5 for the negative control, patient 1 replicates 1,2, 3, and for patient 2 replicates, 1, 2, 3
Make sure the lids are tightly closed
Place tubes into the assigned PCR machine, make sure to appropriately label the side of the PCR machine your group's tubes were placed on for easy identification later on
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 35
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30
seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Q1
Template DNA is used to make the complementary strand. Primers are used to help copy the DNA by attaching to sites on the DNA strands that are at either end of the segment that needs to be copied. Taq polymeraseis an enzyme that assembles new DNA from nucleotides. Deoxyribonucleotides (dNTPs) are the building blocks from which the DNA polymerase (Taq polymerase) uses to make the new DNA strand.
Q2
During the initial step, the system is heated up to 95 degrees Celsius which allows for all of the components to heat up. During the denature phase, which is also at 95 degrees Celsius for 30 seconds the template DNA experiences DNA melting which makes single-stranded DNA. During the anneal phase which is at 57 degrees Celsius for 30 seconds the template the primers are able to attach to the single stranded DNA template. The extension phase takes place at 72 degrees Celsius for 30 seconds, and the Taq polymerase is at its optimum activity level allowing it to assemble a new strand of DNA along with a complementary strand using the deoxyribonucleotides. The final step takes place at 72 degrees Celsius for 3 minutes, and this is just to ensure that all of the single-stranded DNA was extended. The final hold occurs at 4 degrees Celsius and this is for short-term storage of the reaction.
Q3
Adenine pairs with Thymine while Cytosine pairs with Guanine.
Q4
Base-pairing occurs during the extension at 72 degrees Celsius for 30 seconds since at this point a new strand of DNA is being assembled by attaching to the complementary strand. This only occurs through the base pairing. Base pairing also occurs at the anneal phase since the primers must attach to the DNA template, and this probably occurs due to base pairing.
What is a nucleotide? The organic base units of DNA and RNA
What is a polymorphism? A point mutation that is expressed in multiple forms within a population.
What species is this variation found in? (latin name) HomoSapien
What chromosome is the variation located on? chromosome 8
What is listed as the Clinical significance of this SNP? It is contained within a pathogenic allele
Which gene(s) is this SNP associated with? LPL (Lipoprotein Lipase)
Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? Coronary heart disease
What does LPL stand for? Lipoprotein Lipase
What is the function of LPL? To find out, click the LPL link. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see...
1.Apo lipoprotein binding
2.heparin binding
3.lipoprotein lipase activity
What is an allele? A variation in a gene.
The disease-associated allele contains what sequence? The sequence aat.
The numerical position of the SNP is 19956018
Non-disease forward primer (20 nt): aatctgggctatgagatcaa
The numerical position exactly 200 bases to the right of the disease SNP is: 19956218
Non-disease reverse primer (20 nt): gaaacaccagggctcagggt
Disease forward primer (20 nt): aatctgggctatgagatcag
Disease reverse primer (20 nt): gaaacaccagggctcagggt
Primer Design and Testing
.
BME 100 Spring 2015
