BME100 s2015:Group13 12pmL4

BME 100 Spring 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: Unable to save thumbnail to destination Name: Tina Monteilh Role(s) Error creating thumbnail: Unable to save thumbnail to destination Name:Trisha Dasgupta Role(s) Error creating thumbnail: Unable to save thumbnail to destination Name: student Role(s) Error creating thumbnail: Unable to save thumbnail to destination Name:Payson Wallach Role(s) Error creating thumbnail: Unable to save thumbnail to destination Name: Robel Okbe Role(s) LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaqcolorless-master-mix-m714-protocol/) DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G13 + Positive control none G13 - Negative control none G13 1-1 Patient 1, replicate 1 21533 G13 1-2 Patient 1, replicate 2 21533 G13 1-3 Patient 1, replicate 3 21533 G13 2-1 Patient 2, replicate 1 45821 G13 2-2 Patient 2, replicate 2 45821 G13 2-3 Patient 2, replicate 3 45821 DNA Sample Set-up Procedure Collect all needed Materials Label the sides of the PCR tubes with the Tube labels listed above. Place tubes in rack Micropipette 50 microliters of the positive control mix into the empty tube labelled positive control Repeat step 5 for the negative control, patient 1 replicates 1,2, 3, and for patient 2 replicates, 1, 2, 3 Make sure the lids are tightly closed Place tubes into the assigned PCR machine, make sure to appropriately label the side of the PCR machine your group's tubes were placed on for easy identification later on OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 35 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology Q1 Template DNA is used to make the complementary strand. Primers are used to help copy the DNA by attaching to sites on the DNA strands that are at either end of the segment that needs to be copied. Taq polymeraseis an enzyme that assembles new DNA from nucleotides. Deoxyribonucleotides (dNTPs) are the building blocks from which the DNA polymerase (Taq polymerase) uses to make the new DNA strand. Q2 During the initial step, the system is heated up to 95 degrees Celsius which allows for all of the components to heat up. During the denature phase, which is also at 95 degrees Celsius for 30 seconds the template DNA experiences DNA melting which makes single-stranded DNA. During the anneal phase which is at 57 degrees Celsius for 30 seconds the template the primers are able to attach to the single stranded DNA template. The extension phase takes place at 72 degrees Celsius for 30 seconds, and the Taq polymerase is at its optimum activity level allowing it to assemble a new strand of DNA along with a complementary strand using the deoxyribonucleotides. The final step takes place at 72 degrees Celsius for 3 minutes, and this is just to ensure that all of the single-stranded DNA was extended. The final hold occurs at 4 degrees Celsius and this is for short-term storage of the reaction. Q3 Adenine pairs with Thymine while Cytosine pairs with Guanine. Q4 Base-pairing occurs during the extension at 72 degrees Celsius for 30 seconds since at this point a new strand of DNA is being assembled by attaching to the complementary strand. This only occurs through the base pairing. Base pairing also occurs at the anneal phase since the primers must attach to the DNA template, and this probably occurs due to base pairing. What is a nucleotide? The organic base units of DNA and RNA What is a polymorphism? A point mutation that is expressed in multiple forms within a population. What species is this variation found in? (latin name) HomoSapien What chromosome is the variation located on? chromosome 8 What is listed as the Clinical significance of this SNP? It is contained within a pathogenic allele Which gene(s) is this SNP associated with? LPL (Lipoprotein Lipase) Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? Coronary heart disease What does LPL stand for? Lipoprotein Lipase What is the function of LPL? To find out, click the LPL link. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see... 1.Apo lipoprotein binding 2.heparin binding 3.lipoprotein lipase activity What is an allele? A variation in a gene. The disease-associated allele contains what sequence? The sequence aat. The numerical position of the SNP is 19956018 Non-disease forward primer (20 nt): aatctgggctatgagatcaa The numerical position exactly 200 bases to the right of the disease SNP is: 19956218 Non-disease reverse primer (20 nt): gaaacaccagggctcagggt Disease forward primer (20 nt): aatctgggctatgagatcag Disease reverse primer (20 nt): gaaacaccagggctcagggt Primer Design and Testing .