BME100 f2013:W1200 Group13 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Samantha Brenna Name: Briana Ybarra Name: Scott Ashmore Name: Brenda Vargas Name: Joseph Salerno LAB 6 WRITE-UP Computer-Aided Design TinkerCAD Our group used TinkerCAD to create new PCR tubes. The design of the tubes was created while considering organization and ease of handling. The openPCR machine that we used in class is set up to hold four rows of four. We set up our tubes to be in two groups, Each group connected for handling and organization. The first group is the + control and the three trials of patient 1, thus our tubes are labeled so "+" "1-1" "1-2" "1-3" are visible and have a slight grade so they can be felt as well without getting stuck in the machine. The same was done for the second group of tubes with the - control and patient 2's trials respectively. Implications of Using TinkerCAD for Design TinkerCAD could be used practically for this experiment because the design for the OpenPCR machine could be redesigned. The machines that we used had several issues. These issues revolved around overheating and user construction flaws. With these flaws in mind the way we would redesign the machine would be to print the shell of the machine a little bigger, then repositioning the fan so it has two parts, one blowing cold air in and the other moving hot air out. On top of that the heat sink should be moved next to the hot air outtake fan so it is constantly cooled and displacing heat. This will help the overheating issue. The next thing could be to print the machine with small latches or pins because the screws made a screw driver necessary and also cause issues with missing pieces and splitting wood. With each printed perhaps with an L hook and a button the machines would all be put together identically, thus eliminating the user construction problem. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation A nucleotide is the functional unit (monomer) that is a basic component of DNA and RNA molecules. A polymorphism is a common variation in a DNA sequence. The variation rs17879961 is found in the Homo Sapiens species. The clinical significance of this SNP with the pathogenic allele is that it modifies CHEK2. CHEK2 stands for checkpoint kinase 2 which stops the cell from going into mitosis if the DNA is damaged. Typically humans have 23 chromosomes and the SNP of this variation is found on chromosome 22. Primer design Forward Primer: 5'-ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: 5'- GGTCCTAAAAACTCTTACAC How the primers work: Primers are custom pieces of DNA that are made to attach at the top strand of DNA and also at the end of the specific segment of DNA. The two strands are not identical, but they are complimentary. For this experiment the primers are designed to attach to the target strand of DNA then once the solution is placed in the OpenPCR machine it replicates that targets strand and after only a few cycles its already replicating exponential amounts of the target strand. This gives us more of a sample to test from and helps eliminate any factors that we don't want. The primers essentially let us pick a target strand of DNA and isolate it for replication. Feature 2: Consumables Kit Packaging of consumables kit The consumables would be packaged as shown above. The white is the Styrofoam holder for the primers, the light tan 8 x 12 stand is for the pipette tips, and the light blue 8 x 12 stand is for the PCR tubes. The purple cylinder is the pipette and our brand name is located on the bottom of our box as well as on the outside. The packaging is simple and labeled for easy clean up and proper storing. Instructions are also included in the box which can be found lying flat under the Styrofoam holder for the primers. Modifications to consumables kit The primers in the consumable kit will be stored in Styrofoam holders in order to ensure that the primers will not spill or be mixed up. Each primer bottle will be labeled and then placed in the holder in the Styrofoam with the corresponding label. The Styrofoam primer holder will be placed in a box which will also contain pipette tips, PCR tubes, instructions, and micropipette. The PCR tubes will be stored in a 8 x 12 container with them connected in fours for the PCR machine. The pipette tips will also be packaged in 8 x 12 stands in separate boxes to make sure that the package aren't unstable. This will all be packaged in the box with corresponding spots labeled on bottom of the box to make storing easier. Feature 3: PCR Machine Hardware The PCR machine will be packaged separately from the box of consumables that way it does not damage any of the items. They can be bought together in a complete package but they will not be stored together to avoid any damage to the PCR machine or the consumables. The tube holders in the PCR machine would have a stopper in the corner to make sure that the lid is on all the way and not breaking the tubes. This is a simple modification that can create more accuracy. The stopper would be the slightly higher than the tubes but not enough to make the tubes not touch the lid. It is higher enough to take the pressure from the lid off the tubes, but not enough to effect the experiment. Feature 4: Fluorimeter Hardware The fluorimeter is used to test for cancer in a sequence. A camera phone is used to take a picture of the florescence of the SYBR green dye mixed with PCR sample. The setup of the fluorimeter includes a stand for the camera, which helps the camera stay upright to take the picture, a black box to cover the phone stand and the dye. The black box blocks out light so results aren't affected. Redesign of Fluorimeter: The Fluorimeter would be redesigned to decrease the opportunity for error. One aspect of the design would be connecting the actual Fluorimeter with the slide holder to the camera phone holder. This would be an adjustable sliding platform with a ruler in order to record how far it is from the drop and then moving the machine wouldn't affect the experiment. Before, it was difficult to get an accurate measurement of this distance which made it difficult to keep the distance consistent across several experimental groups. Another portion of the redesign includes connecting this sliding platform of the Fluorimeter to another sliding platform under the black box. This would allow one to take the pictures with blocking more light making the experiment more accurate. Having all of the parts of the device connected and adjustable makes the experiment more accurate because there can be more aspects constant. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach The Bayesian statistics equation is written as P(A|B)=(P(B|A)*P(A))/P(B). Bayesian statistics is a way to determine the reliability of predicting cancer and detecting cancer SNPs. Calculation 3 asked what the probability is that the patient will develop cancer given they have the cancer DNA sequence. The P(A|B) value for calculation is less than one. Calculation 4, P(A|B) was also less than one, making both of the calculations very inaccurate. Calculation 4 asked what the probability is that the patient won’t develop cancer given a non-cancer DNA sequence. Therefore, the reliability of CHEK2 PCR for predicting cancer isn't accurate and shouldn’t be relied for cancer detection. There is human error from the PCR machines and also some of the data was not used because results couldn’t be drawn from them due to incomplete tests. Since the number of tests was smaller than expected, this could have affected the outcomes. If both the P(A|B) and P(B|A) value were closer to 1 the test would be a reliable way to determine if a patient has cancer or not. However since they are very small it is not a reliable determination for the prediction of cancer in a patient.