Alyssa N Weisblatt Lab Notebook

From OpenWetWare
Jump to navigationJump to search

Alyssa'a Lab Notebook

Relevant Links

Dahlquist Lab

Lactase Persistence

Alyssa's User Page

Week 5

June 18, 2019

Goals:

  • Analyze SNP sequence results of CC#3 plasmids using Blast2Seq
  • Upload edited files to Box

Results:

Sequence Results

CC3-1 with M13F primer and CC3-2 with M13R primer BLAST

  • CC3-2 had majority of the sequence be Ns and could not be compared to CC3-1.

CC3-1 with M13F primer edited with PCR Sequence BLAST

  • Query cover = 85%
  • Percent identification = 100.00%
    • 437/437 bp
  • Query length = 448
  • Max/total score = 808
  • Accession = Query_66867
  • E value = 0.0

CC3-2 with M13R primer edited with PCR Sequence BLAST

  • Majority of the sequence was Ns and could not be compared to the PCR Sequence.

CC3-3 with Lac-for primer edited with CC3-4 with Lac-rev primer BLAST

  • Query cover = 100%
  • Percent identification = 100.00%
    • 341/341 bp
  • Query length = 341
  • Max/total score = 630
  • Accession = Query_195115
  • E value = 0.0

CC3-3 with Lac-for primer edited with PCR Sequence BLAST

  • Query cover = 100%
  • Percent identification = 100.00%
    • 341/341 bp
  • Query length = 448
  • Max/total score = 630
  • Accession = Query_54089
  • E value = 0.0

CC3-4 with Lac-rev primer edited with PCR Sequence BLAST

  • Query cover = 100%
  • Percent identification = 100.00%
    • 341/341 bp
  • Query length = 448
  • Max/total score = 630
  • Accession = Query_53535
  • E value = 0.0

Fall 2019 Semester

November 12, 2019

Lefever, S., Rihani, A., Van der Meulen, J. et al. Cost-effective and robust genotyping using double-mismatch allele-specific quantitative PCR. Sci Rep 9, 2150 (2019) doi:10.1038/s41598-019-38581-z

  • They used annealing temp of 60C for 30 sec

What is the significant difference between Cq to be a robust genotype assay?

  • Supplementary Table 1: For each genotype they calculated the mean Cq difference (dCq +/- standard deviation)
    • They then calculated ddCq (absolute difference between mean dCq value of heterozygous samples and the dCq value of homozygous samples), which represents the degree in discriminating power
    • Found that none of the single 3’ terminal mismatches did not have a high enough discriminatory power to reliably call genotype
  • Figure 2: mismatches on positions two and three result in highest average dCq differences (ddCq) (and thus highest discriminating power)
    • Figure 2A: Upon examining the figure, the mismatch positions at two and three have a large ddCq (difference between hetero- and homozygote dCq), which is around 12
    • Figure 2B: mismatch on position three appears to be optimal position because has low standard deviation and limited effect on the match and large and reproducible dCq value between ‘match’ and ‘mismatch’ reactions
  • Supplementary Figure 1: examined Cq scatterplots and it supported position three having the clearest clustering of the three different genotypes
    • The axes are Cq primer allele X and Cq primer allele Y
      • The heterozygous genotype has two low Cq values and is centered on the bottom left corner
      • The other two genotypes cluster at either the upper left or the lower right corner
        • The less crossing over, the better
  • Figure 3: Cq difference plot of data demonstrated that in 98% of DNA sample-concentration combinations the correct genotype could be determined (using a 5 dCq cut-off)
    • Discrimination power of assay decreases with lower concentrations of input DNA, but wide concentration range assays still able to discriminate between genotypes, which confirms the sensitivity and robustness of the method
  • Figure 4 and Supplementary Table 2: all 576 genotypes could be called using their method with a manually set threshold (100% call rate) while 23 TaqMan reactions resulted in undetermined calls (96% call rate using the TaqMan Genotyper software)
  • Figure 6: dCq values deviate from theoretical trend line for the higher target dilutions
    • Used conservative 2 dCq cut-off
    • This can most likely be attributed to specificity of the assay since at very low mutant concentrations, the mutant primer will start competing with the wild-type primer to amplify the wild-type allele
      • Nevertheless, when using conservative 2 dCq difference to discriminate between wild-type and mutant in wild-type sample, sensitivity scores ranging from 6.25% down to 0.05% (mutant in WT) can be reached without any optimization

Identifying Second Mismatch in qPCR Primers

Original primers:

  • Forward primer sequence:
5'-GAGTGTAGTTGTTAGACGGAGAC-3'
  • qPCR primer sequence for T genotype:
5'-AGGCCAGGGACTACATTATC-3'
  • qPCR primer sequence for C genotype:
5'-AGGCCAGGGGCTACATTATC-3'

Additional Mismatch: fourth nucleotide from the primer 3' end

  • Forward primer sequence:
5'-GAGTGTAGTTGTTAGACGGAGAC-3'
  • qPCR primer sequence for T genotype: T/A
5'-AGGCCAGGGACTACATAATC-3'
  • qPCR primer sequence for C genotype: T/A
5'-AGGCCAGGGGCTACATAATC-3'

Note that because the original mismatch occurs near the middle of the primer, except at the end, the original design is not compliant with the DMAS assay described by Lefever et al. (2019). I submitted a primer design request via PrimerXL. Kam D. Dahlquist (talk) 09:18, 15 November 2019 (PST)

November 19, 2019

Finding Where the Amplicon and the Clone Sequence Align

Sequence: PCR product 5' to 3' (below; primer binding sites are bolded, FaqI restriction enzyme recognition site is underlined, ^ marks the cut site, it has a four nucleotide 5' extension)

GGATGCACTG  CTGTGATGAG GTATCAGAGT CACTTTGATA TGATGAGAGC
AGAGATAAAC  AGATTTGTTG CATGTTTTTA ATCTTTGGTA TGGGACATAC
TAGAAT^TCAC TGCAAATACA TTTTTATGTA ACTGTTGAAT GCTCATACGA
CCATGGAATT  CTTCCCTTTA AAGAGCTTGG TAAGCATTTG AGTGTAGTTG
TTAGACGGAG  ACGATCACGT CATAGTTTAT AGAGTGCATA AAGACGTAAG
TTACCATTTA  ATACCTTTCA TTCAGGAAAA ATGTACTTAG ACCCTACAAT
GTACTAGTAG  GCCTCTGCGC TGGCAATACA GATA^AGATAA TGTAG C/T CCCT
GGCCTCAAAG  GAACTCTCCT CCTTAGGTTG CATTTGTATA ATGTTTGATT
TTTAGATTGT  TCTTTGAGCC CTGCATTCCA CGAGGATAGG TCAGTGGG

Amplicon:

GCGAAGATG   GGACGCTTG  AATGCCCTT  TCGTACTAC  TCCCCTTTT 
ACCTCGTTA   ATACCCACT  GACCTATCC  TCGTGGAAT  GCAGGGCTC 
AAAGAACAA   TCTAAAAAT  CAAACATTA  TACAAATGC  AACCTAAGG 
AGGAGAGTT   CCTTTGAGG  CCAGGGGCT  ACATTATCT  TATCTGTAT 
TGCCAGCG

BLAST 2 Sequence Comparison Between Clone Sequence and Amplicon:

Comparison of clone sequence to amplicon BLAST.png

Reverse Primer Sequences with and without mismatch:

with: underlined portion

1. CGCTGGCAATACAGATAAGATAATGCAGC
2. CGCTGGCAATACAGATAAGATAATGCAGT

without: underlined portion

1. CGCTGGCAATACAGATAAGATAATGTAGC
2. CGCTGGCAATACAGATAAGATAATGTAGT


Primer BLAST Comparing Amplicon, Forward Primer, and Reverse C Primer:

Primer BLAST of amplicon, forward primer, and reverse 1 cropped.png

Primer BLAST Comparing Amplicon, Forward Primer, and Reverse T Primer:

Could not be completed: "specified right primer cannot be found on template."