Biomod/2013/Todai/Design

From OpenWetWare
Revision as of 06:59, 31 August 2013 by Kenta Koyama (talk | contribs)
Jump to navigationJump to search

<html> <head> <meta name="viewport" content="width=1200">

<style>

</style> </head>

<body>

     <figure>
     </figure>
   


</body> </html>

<html> <head> <title>Design-Todai nanORFEVRE-</title> <style>

.rightbar-des {

 font-size: 90%;
 width: 155px;
 background-color: #ffffff;
 padding: 5px;
 padding-right:0px;
 position: fixed;
 top: 220px;
 left: auto;
 z-index: 20;
 margin: 0 0 0 797px;
 border:solid 1.5px orange;
 }

.rightbar-des ul {

 position:relative;
 left:-15px;
 line-height:1.5;
 list-style:none;
 }

.rightbar-des ul li {

 }

.rightbar-des ul li ul li{

 position:relative;
 left:10px;
 }

.reference-title {

 font-size:110%;
 font-weight:bolder;
 }

.reference-author {

 font-size:110%;
 }

.reference-journal {

 font-size:110%;
 font-style:italic;
 }

</style>

</head>

<body>


  • <a href="#1.Oligomeric Cell Killer">1. Oligomeric Cell Killer</a>
    • <a href="#1-1.General design">1-1.
      General design</a>
  • <a href="#2.Cylinder in barrel by DNA origami">2. Cylinder in barrel</a>
    • <a href="#2-0.Purpose">2-0.
      Purpose</a>
    • <a href="#2-1.Geometrical features">2-1.
      Geometrical features</a>
    • <a href="#2-2.Functional features">2-2.
      Functional features</a>


<a name="Design"> Design</a>

  


<a name="1.Oligomeric Cell Killer"> 1. Oligomeric Cell Killer</a>


  <article>

<a name="1-1.General design"> 1-1. General design</a>

   
    <figure>
      <img src="http://openwetware.org/images/a/ac/Des1-Todai.png" width="300" height="300">
     <figcaption style="font-size:110%;position:relative;left:-20px;">
     General Design
     </figcaption>
    </figure>
    

It is our goal for DNA nanostructure to kill a cell by forming a pore like MAC in immune system. Therefore, we intended to design a DNA nanostructure which imitates its pore formation system by oligomerizaton. The designed structure is shown below, and this design is characterized with three features: a broad plane, bend of side edges and connectable sites.

It requires enough free energy to penetrate membranes. By anchoring to the lipid bilayer by cholesterol modified staples, the DNA nanostructure is expected to get over the potential barrier. The more cholesterols are equipped to the structure, the more stabilized it stays near the membrane. A broad plane gives much cholesterol binding sites, so this feature is suited to penetrate membranes.

From previous(Danilo D. Lasic, et al.) research <a href="#desref-1">[1]</a>, it is suspected that DNA nonspecifically interacts with liposomes. Hence it seems the designed structure should not have any broad plane contactable to membrane undesirably, but that we thought we take advantage of this enforced interaction and can prevent undesirable connection to the membrane. So this broad plane do good rather than do harm.

To oligomerize, the DNA nanostructure must have some binding site to each other. Though hybridization is used as the method of oligomerization in the figure, but we examine other method as well.

    

This general design with these features are mainly derived from prediction, and were information necessary to design our nanostructure more specifically, for example, we need to know about the interaction between DNA and liposome(as cell membrane) and develop assay. We simplyfied our general design, and made “Cylinder in barrel”. We did some experiments with “Cylinder in barrel” in advance to the more specific design.

  </article>
  


<a name="2.Cylinder in barrel by DNA origami"> 2. Cylinder in barrel by DNA origami</a>

  
  <iframe width="420" height="315" src="http://www.youtube.com/embed/2I802ed96t0?rel=0" frameborder="0" allowfullscreen>
  </iframe>
  


  <article>

<a name="2-0.Purpose"> 2-0. Purpose</a>

   

This barrel structure was designed first in order to get some feedback for our general design. caDNAno(version 2.2)was used to design the structure, and M13mp18 was chosen as the scaffold strand.

    

General design needs to oligomerize and form pore on the membrane, so we check following things by Cylinder.

       <figure>
         <img src="http://openwetware.org/images/4/42/Des2_0purpose-Todai.png" width="420" height="420" style="border:solid 1.5px black;">
        

<figcaption style="position:relative;left:-10px;"> What is intended to confirm by "Cylinder". </figcaption> </figure>
    

1) Can DNA nanostructures penetrate lipid membranes?

2) Can DNA nanostructures bind each other and make dimer(or more complex structure )in solution?

3) Is that connection possible with penetrating membranes?

4) Can the direction of connection be controlled?

    

Therefore, the structure was equiped with following features.

  </article>
  


  <article>

<a name="2-1.Geometrical features"> 2-1. Geometrical features</a>

    
<figure>
      <img src="http://openwetware.org/images/7/79/BarrelSize-Todai.png" width="300px" height="300px" >
     <figcaption style="position:relative;left:-25px;">
     The dimentions of a cylinder in barrel
     </figcaption>
    </figure>
    

To get reliable information, the design of cylinder needs to be simple and realistic. We refered to the past research (Martin Langecker et al.)<a href="#desref-2">[2]</a>and designed geometrical features.

The cylinder domain is about 65nm long(195bp) and consists of six dsDNA helixes, so its diameter is 6nm long. The barrel domain is approximately 43nm long(128bp) and 48 helixes builds this domain. Because the part of the cylinder sticking out needs to penetrate lipid membranes, which is 2nm thick liposome used in experiments, the length of that part(about 20nm) is enough to go through lipid membranes. By covering the cylinder with barrel, this structure can be equiped with more cholesterols than that without barrels.

(Cholesterol is necessary to penetrate membranes, about which is written in next section.)

  </article>
  


  <article>

<a name="2-2.Functional features"> 2-2. Functional features</a>

    
<figure>
      <img src="http://openwetware.org/images/a/a1/BarrelCholesterol-Todai.png" width="300px" height="300px" >
      

<figcaption style="position:relative;left:-10px;"> How "Cylinder" penetrates membranes </figcaption> <figcaption style="position:relative;left:-10px;"> (This arrangement of lipids is refered to previous research. <a href="#desref-2">[2]</a>) </figcaption>
    </figure>
    

Because DNA has negative charge, the DNA nanorobots have to gain some energy to penetrate lipid membrane, which is composed of amphiphilic molecules. This problem is solved by binding cholesterols to the structures. The barrel domain has 26 staple strands complementary to cholesterol modified DNA oligo, and the oligomers are hybridized to these staples.The DNA structure anchors itself to membrane by cholesterols, and it gives stability for the structure to stay near membranes.Therefore, the structure can pierce lipid bilayer.

    


       <figure>
         <img src="http://openwetware.org/images/e/e3/Des2_2_3rdparagraph1-Todai.png" width="200px" height="200px" >
         <figcaption>[Mechanism of binding-1]</figcaption>
         <figcaption>
         dimerized by the strands 
sticking out from the top </figcaption> </figure>
       <figure>
         <img src="http://openwetware.org/images/7/7a/Des_2_2_3rdparagraph2-Todai.png" width="200px" height="200px" >
             <figcaption>[Mechanism of binding-2]</figcaption>
             <figcaption>dimerized by the strands 
sticking out from the side </figcaption> </figure>

Three different sequences of staples to hybridize cholesterol modified oligomers were prepared.

1:CCTCTCACCCACCATTCATC (from previous research(Alexander johnson-Buck et al.<a href="#desref-3">[3]</a>))

2:TAACAGGATTAGCAGAGCGAGG (from previous research(Martin Langecker et al.<a href="#desref-2">[2]</a>))

3:GGAACTTCAGCCCAACTAACATTTT

They are different in the length of the hybridizing sequence. About cholesterol modified oligomers, their sequences are perfectly complementary to the three sequences above, and their 5' ends are modified by a cholesterol.

To achieve the purpose iii), the structure has binding site by hybridization. Two pairs of sequences were assigned for hybridization. Both are refered to previous work about logic-gated nanorobot of DNA(Shawn M. Douglas, et al. <a href="#desref-4">[4]</a>). They are derived from aptamer sequence,one is TE17, the other is sgc8c(and the complementary strands to these, so two pairs). These sequences were chosen because it is considered that these sequences don't prevent the folding of scaffold. The sequences of them are below:

1:TCTAACCGTACAGTATTTTCCCGGCGGCGCAGCAGTTAGA TT(sgc8c aptamer + TT)

2:TT CAGCACCCAGTCAGAAGCAGGTGTTCGGAGTTTTGTATTGCGTAGCTG(TT+ TE17 aptamer )

Designed structures have either the aptamer sequences(1,2) or the two complementary strands(1,2). When two structures with different pairs are mixed and hybridization happens, these structures hence bind each other through two binding sites. Two types of binding sites were designed to test that the direction of connection can be controlled. One type of binding site uses staples sticking out from the ends of scaffolds. The other from near sites, but the direction in which staples stick out is controlled. It is intended to controll the direction of binding by the intereference between structure and hybridized aptamers.

    <figure>
      <img src="http://openwetware.org/images/5/5a/Des_2_2_4thparagraph-Todai.png" width="300px" height="300px" >
     <figcaption style="position:relative;left:-20px">
     Fluorescent materials are equipped 
     
by streptavidin-biotin interaction. </figcaption>
    </figure>
    

To detect the cylinder piercing membrane, two biotin modified staple strands are out from its bottom. Streptavidins with fluoresence bind them in advance, and only the cylinders penetrating liposome are protected from protease when the cylinders are mixed with liposome. Therefore, it is possible to observe whether there are cylinders penetrating by their fluoresence.

    

From the results of experiments with “Cylinder” we will decide our final design.

  </article>
  


  <article>

<a name="References"> References</a>

    


         <a name="#desref-1">
         [1] The Structure of DNA−Liposome Complexes
         </a>
          Danilo D. Lasic,Helmut Strey, Mark C. A. Stuart, Rudolf Podgornik,  and Peter M. Frederik
             Journal of the American Chemical Society 1997 119 (4), 832-833 
    
       <a name="#desref-2">
       [2] Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures 
       </a>
          Martin Langecker, Vera Arnaut, Thomas G. Martin, Jonathan List, Stephan Renner, Michael Mayer, Hendrik Dietz, and Friedrich C. Simmel
             Science 16 November 2012: 338 (6109), 932-936. [DOI:10.1126/science.1225624] 
    
       <a name="#desref-3">
       [3] Multifactorial Modulation of Binding and Dissociation Kinetics on Two-Dimensional DNA Nanostructures
       </a>
          Alexander Johnson-Buck, Jeanette Nangreave, Shuoxing Jiang, Hao Yan, and Nils G. 
             WalterNano Letters 2013 13 (6), 2754-2759
    
       <a name="#desref-4">
       [4] A logic-gated nanorobot for targeted transport of molecular payloads. 
       </a>
          S. M. Douglas, I. Bachelet, G. M. Church
             Science 335, 831 (2012)


  </article>
  







<footer style="position:relative;left:400px"> Copyright © Todai nanORFEVRE, all rights reserved. </footer> </body> </html>