Talk:20.109(S11):Complete DNA design (Day2)

From OpenWetWare
Revision as of 00:42, 10 April 2011 by AgiStachowiak (talk | contribs) (W/F)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

High-level designs and implementation with primers: original tables

T/R

Group Summary of approach
Blue The Plux-lamda promoter may be leaky due to the high basal expression of the Pr promoter. We are deleting part of the -35 region (after Or2) in the Pr promoter and adding 2 G's in the middle of -10 region (right after Or1) in order to reduce the strength of the promoter and decrease the AT richness in the sequence.
Pink We are inserting a second copy of the Or1 sequence directly infront of Or2 to hopefully improve repressing of the operons
Green We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference.
Yellow We decided to change 2 nucleotides in the -35 region of P(R), and 1 nucleotide in the -10 region. We also added an extra basepair to between these two regions, increasing its length. These changes make the promoter less ideal of a binding site, therefore making it a weaker promoter. We chose the changes in nucleotides based on the lac promoter consensus sequence.
Red We decided to drastically mutate the -10 and -35 sequences located inside of the Or2 operator in hopes of weakening the promoter without significantly weakening the repressor binding. We made these sequences g and c rich since they are usually t and a rich.
Purple We are substituting the TTT base pair sequence between OR1 and OR2 regions to GGG. This way, we can avoid changing the OR1 and OR2 while changing the promoter region and possibly reducing its activation level. Because bacteria promoters are often rich in A's and T's, we chose to change the TTT to GGG.
Orange design rationale:

to reduce the strength of the promoter, we decided that the best candidate regions to alter would be the -35 and -10 upstream regulatory regions. Since altering more than 1 region at a time could have confusing effects (i.e. it gets harder to detect which change caused what effect), we decided to finally just change the -10 region, as it would have a more pronounced effect (since it is closer to the promoter). The -10 region has bases GATA. We wanted to replace these 4 bases, and also ensure that our new sequence was not similar to the consensus sequences. We were also curious to know what might happen if we used the last 4 bases of the OR2 region instead of these 4 bases, since these 4 happen to be the last 4 bases of the OR1 region. Thus, we ended up replacing the GATA by GTTG.


Group Forward primer; <br>Reverse primer Summary of approach
Blue 5’CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGTTTTACCTCTGGCGGTGATAGGG3’
5’GATCCCCTATCACCGCCAGAGGTAAAACAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3’
The Plux-lamda promoter may be leaky due to the high basal expression of the Pr promoter. We are deleting part of the -35 region (after Or2) in the Pr promoter and adding 2 G's in the middle of -10 region (right after Or1) in order to reduce the strength of the promoter and decrease the AT richness in the sequence.
Pink 5'CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATACCTCTGGCGGTGATATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAGGATCC3'

5'AAATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATATCACCGCCAGAGGTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3'

We are inserting a second copy of the Or1 sequence directly infront of Or2 to hopefully improve repressing of the operons
Green 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCCCCTAACACCGTGCGTGTTGCCCCTTTTACCTCTGGCGGTGATACCGGATCC3’
3'GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGGGGATTGTGGCACGCACAACGGGGAAAATGGAGACCGCCACTATGGCCTAGG5'
We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference.
Yellow 5' CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTTGCTATTTTTACCTCTGGCGGTGATATTGGATCC 3'

5’GGATCCAATATCACCGCCAGAGGTAAAAATAGCAAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3’

We decided to change 2 nucleotides in the -35 region of P(R), and 1 nucleotide in the -10 region. We also added an extra basepair to between these two regions, increasing its length. These changes make the promoter less ideal of a binding site, therefore making it a weaker promoter. We chose the changes in nucleotides based on the lac promoter consensus sequence.
Red 5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGGGTGGCACCGTGCGTGGCACTGGTTTTACCTCTGGCGGTGATAG3'

5'GATCCTATCACCGCCAGAGGTAAAACCAGCGACACGCACGGTGCCACCCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3'

We decided to drastically mutate the -10 and -35 sequences located inside of the Or2 operator in hopes of weakening the promoter without significantly weakening the repressor binding. We made these sequences g and c rich since they are usually t and a rich.
Purple 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTAGGGTACCTCTGGCGGTGATAGGATCC3’

5'GGATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG3’

We are substituting the TTT base pair sequence between OR1 and OR2 regions to GGG. This way, we can avoid changing the OR1 and OR2 while changing the promoter region and possibly reducing its activation level. Because bacteria promoters are often rich in A's and T's, we chose to change the TTT to GGG.
Orange updated sequences:

sense strand: 5’-CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGGGATCC – 3’

complement: 3’-GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAGG – 5’

design rationale:

to reduce the strength of the promoter, we decided that the best candidate regions to alter would be the -35 and -10 upstream regulatory regions. Since altering more than 1 region at a time could have confusing effects (i.e. it gets harder to detect which change caused what effect), we decided to finally just change the -10 region, as it would have a more pronounced effect (since it is closer to the promoter). The -10 region has bases GATA. We wanted to replace these 4 bases, and also ensure that our new sequence was not similar to the consensus sequences. We were also curious to know what might happen if we used the last 4 bases of the OR2 region instead of these 4 bases, since these 4 happen to be the last 4 bases of the OR1 region. Thus, we ended up replacing the GATA by GTTG.


W/F

Group Summary of approach
Yellow We chose to modify both the lambda -10 region and the lux box of the hybrid promoter. We modified our -10 region the same as TR Orange (GATA –> GTTG) to reduce the basal expression level. We determined from a primary source that modification of A7 to guanine yields ~25% reduction in promoter activity. Anticipating the reduced ability of cI protein product to repress in the aforemention -10 region, we are also reducing the activity of the lux box as compensation.
Purple In order to decrease the strength of the promoter and stop leaky expression of lacZ, we wanted to decrease the binding affinity that RNA polymerase had for the -10 and -35 regions of the lambda promoter. We found the araBAD promoter, which is a weak promoter for RNAP, so we completely changed the -35 region to match araBAD and changed only the last two base pairs of the -10 region to match araBAD. We didn’t want to change the “GATA” of the -10 region in the OR1 because we didn’t want to affect repression by c1 (OR1 is more important to c1 repression than OR2).
Green We found online that the -10 region is necessary for transcription, but the -35 region just increases the amount of transcription. We didn’t want to change these regions in the PluxI part of the promoter, because we want transcription of the downstream sequence to be high when the AHL-LuxR complex binds to PluxI to activate transcription. However, we don’t want lacZ to be transcribed unless the repressor is absent. In the current system, since we have the essential -10 region, it is still possible for transcription of lacZ to occur in the absence of activator, so long as the repressor is not present, especially since PR does not require an activator, as stated on the Module 2 Day 2 wiki. So, if we mutate the -10 region of PR such that it can no longer activate transcription, the only way that the lacZ gene can be expressed is if the AHL-LuxR complex is present to initiate transcription from the PluxI -10 region. Since binding of the repressor at OR2 increases the binding of the repressor at OR1 by 10 fold, again as stated on the Module 2 Day 2 wiki, we hope that changing the portion of the -10 region that overlaps with OR1 will not significantly affect the binding of the repressor.
Blue We chose to mutate the -35 region of P(R) that doesn't have an overlap with the OR2 region, since we think the -35 region of P(R) isn't necessary for transcription of P(lux-lambda). Hopefully this will reduce the basal expression of P(lux-lambda). We switched 3 base pairs (ACT) to (CAC) based on looking at the consensus sequence and modifying it to look as different as possible.
Red We decided to mutate the -35 and -10 regions upstream of the operator regions because we know the lux box and operator sites are essential for the luxI c1 system. We changed the second Ts to As, for both the -35 and -10 site as this change is known to be particularly deleterious. We then changed most of the As and Ts to Gs and Cs to differ from the consensus sequences since these -10 and -35 regions are normally A-G rich.
PINK We modified our strand by taking out the Or2 site and replacing it with a second copy of the Or1 site. We did this in hopes of increasing the suppressing strength. We also changed the seven-base spacing between the operator sites to read GCTTGGC. We decided to change this space to disrupt the binder of the Pr promoter . We are trying to down-express lambda promoter and hopefully improved the suppressor binding.
Orange We reasoned that we had to fix both the leaky expression in the case where cI is present and the high expression when AHL is not present. Since the Lux Box is necessary for binding of the LuxR-AHL complex, we left its sequence alone. In order to reduce expression in the presence of cI, we then eliminated base pairs between the Lux Box and the OR1 site until we were able to include the -10 for the Lux portion of the promoter in the OR1 site. We also mutated a single base in the OR2 site to increase homology of the -10 with the TATAAT consensus sequence, allowing increased expression when cI is not binding the OR2 site. In addition, we mutated bases toward the end of the OR1 site in order to eliminate the partial -10 site that is present there (mostly by changing purines to pyrimidines), and we modified two bases that are outside of the OR2 site but still contribute to the -35 consensus sequence site found in the pR part of the original R0065 promoter.


Group Forward primer; <br>Reverse primer Summary of approach
Yellow 5’CCGGGTAAGCACCTGTGGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGG3’

3’CATTCGTGGACACCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAG5’

We chose to modify both the lambda -10 region and the lux box of the hybrid promoter. We modified our -10 region the same as TR Orange (GATA –> GTTG) to reduce the basal expression level. We determined from a primary source that modification of A7 to guanine yields ~25% reduction in promoter activity. Anticipating the reduced ability of cI protein product to repress in the aforemention -10 region, we are also reducing the activity of the lux box as compensation.
Purple 5’CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGCTGACGTTTTACCTCTGGCGGTGATAGTCCTAG3’

3’GGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACGACTGCAAAATGGAGACCGCCACTATCAGGATC5’

In order to decrease the strength of the promoter and stop leaky expression of lacZ, we wanted to decrease the binding affinity that RNA polymerase had for the -10 and -35 regions of the lambda promoter. We found the araBAD promoter, which is a weak promoter for RNAP, so we completely changed the -35 region to match araBAD and changed only the last two base pairs of the -10 region to match araBAD. We didn’t want to change the “GATA” of the -10 region in the OR1 because we didn’t want to affect repression by c1 (OR1 is more important to c1 repression than OR2).
Green 5’ – CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGCGCATG– 3’

5’ – GATCCATGCGCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC – 3’

We found online that the -10 region is necessary for transcription, but the -35 region just increases the amount of transcription. We didn’t want to change these regions in the PluxI part of the promoter, because we want transcription of the downstream sequence to be high when the AHL-LuxR complex binds to PluxI to activate transcription. However, we don’t want lacZ to be transcribed unless the repressor is absent. In the current system, since we have the essential -10 region, it is still possible for transcription of lacZ to occur in the absence of activator, so long as the repressor is not present, especially since PR does not require an activator, as stated on the Module 2 Day 2 wiki. So, if we mutate the -10 region of PR such that it can no longer activate transcription, the only way that the lacZ gene can be expressed is if the AHL-LuxR complex is present to initiate transcription from the PluxI -10 region. Since binding of the repressor at OR2 increases the binding of the repressor at OR1 by 10 fold, again as stated on the Module 2 Day 2 wiki, we hope that changing the portion of the -10 region that overlaps with OR1 will not significantly affect the binding of the repressor.
Blue 5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGCACATTTTACCTCTGGCGGTGATAG3’

5'GATCCTATCACCGCCAGAGGTAAAATGTGCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3

We chose to mutate the -35 region of P(R) that doesn't have an overlap with the OR2 region, since we think the -35 region of P(R) isn't necessary for transcription of P(lux-lambda). Hopefully this will reduce the basal expression of P(lux-lambda). We switched 3 base pairs (ACT) to (CAC) based on looking at the consensus sequence and modifying it to look as different as possible.
Red 5’CCGGGTAAGCACCTGTAGGATCGTACAGGGAGCCGCAAGAAAATGGTTAGGGCTAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAG3’

5’GATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTAGCCCTAACCATTTTCTTGCGGCTCCCTGTACGATCCTACAGGTGCTTAC3’

We decided to mutate the -35 and -10 regions upstream of the operator regions because we know the lux box and operator sites are essential for the luxI c1 system. We changed the second Ts to As, for both the -35 and -10 site as this change is known to be particularly deleterious. We then changed most of the As and Ts to Gs and Cs to differ from the consensus sequences since these -10 and -35 regions are normally A-G rich.
PINK 5'CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGATAACTACCTCTGGCGGTGATAGCTTGGCTACCTCTGGCGGTGATAATGGATCC3'

5'GGATCCATTATCACCGCCAGAGGTAGCCAAGCTATCACCGCCAGAGGTAGTTATCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG3'

We modified our strand by taking out the Or2 site and replacing it with a second copy of the Or1 site. We did this in hopes of increasing the suppressing strength. We also changed the seven-base spacing between the operator sites to read GCTTGGC. We decided to change this space to disrupt the binder of the Pr promoter . We are trying to down-express lambda promoter and hopefully improved the suppressor binding.
Orange 5' - CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTCGTATAATACCGTGCGTGTTGAAGATTTTACCTCTGGCGGTGGTGG -3'

5' - GATCCCACCACCGCCAGAGGTAAAATCTTCAACACGCACGGTATTATACGAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC -3'

We reasoned that we had to fix both the leaky expression in the case where cI is present and the high expression when AHL is not present. Since the Lux Box is necessary for binding of the LuxR-AHL complex, we left its sequence alone. In order to reduce expression in the presence of cI, we then eliminated base pairs between the Lux Box and the OR1 site until we were able to include the -10 for the Lux portion of the promoter in the OR1 site. We also mutated a single base in the OR2 site to increase homology of the -10 with the TATAAT consensus sequence, allowing increased expression when cI is not binding the OR2 site. In addition, we mutated bases toward the end of the OR1 site in order to eliminate the partial -10 site that is present there (mostly by changing purines to pyrimidines), and we modified two bases that are outside of the OR2 site but still contribute to the -35 consensus sequence site found in the pR part of the original R0065 promoter.


Exact sequences ordered

T/R

Group Forward primer; <br>Reverse primer
Red CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGGGTGGCACCGTGCGTGGCACTGGTTTTACCTCTGGCGGTGATAG
GATCCTATCACCGCCAGAGGTAAAACCAGCGACACGCACGGTGCCACCCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Orange CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTG
GATCCCAACACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Yellow CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTTGCTATTTTTACCTCTGGCGGTGATATTG
GATCCAATATCACCGCCAGAGGTAAAAATAGCAAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Green CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCCCCTAACACCGTGCGTGTTGCCCCTTTTACCTCTGGCGGTGATACCG
GATCCGGTATCACCGCCAGAGGTAAAAGGGGCAACACGCACGGTGTTAGGGGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Blue CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGTTTTACCTCTGGCGGTGATAGGG
GATCCCCTATCACCGCCAGAGGTAAAACAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Pink CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATACCTCTGGCGGTGATATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAG
GATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATATCACCGCCAGAGGTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Purple CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTAGGGTACCTCTGGCGGTGATAG
GATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC

W/F

Group Forward primer; <br>Reverse primer
Red CCGGGTAAGCACCTGTAGGATCGTACAGGGAGCCGCAAGAAAATGGTTAGGGCTAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAG
GATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTAGCCCTAACCATTTTCTTGCGGCTCCCTGTACGATCCTACAGGTGCTTAC
Orange CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTCGTATAATACCGTGCGTGTTGAAGATTTTACCTCTGGCGGTGGTGG
GATCCCACCACCGCCAGAGGTAAAATCTTCAACACGCACGGTATTATACGAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Yellow CCGGGTAAGCACCTGTGGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGG
GATCCCAACACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCCACAGGTGCTTAC
Green CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGCGCATG
GATCCATGCGCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Blue CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGCACATTTTACCTCTGGCGGTGATAG
GATCCTATCACCGCCAGAGGTAAAATGTGCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Pink CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGATAACTACCTCTGGCGGTGATAGCTTGGCTACCTCTGGCGGTGATAATG
GATCCATTATCACCGCCAGAGGTAGCCAAGCTATCACCGCCAGAGGTAGTTATCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC
Purple CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGCTGACGTTTTACCTCTGGCGGTGATAGTCCTAG
GATCCTAGGACTATCACCGCCAGAGGTAAAACGTCAGCACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC