Talk:20.109(S13):Context-setting and primer design (Day1): Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Katie Bodner (talk | contribs) No edit summary |
|||
| Line 18: | Line 18: | ||
|- | |- | ||
| Grey (Platinum) :) | | Grey (Platinum) :) | ||
| | | ccagccaggacagaatggag | ||
| | | GGA GAT AAC ACC TGG AAT GGT CTG | ||
| | | | ||
| | | | ||
Revision as of 22:09, 7 February 2013
T/R section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
| Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Grey (Platinum) :) | ccagccaggacagaatggag | GGA GAT AAC ACC TGG AAT GGT CTG | |||
| Green | |||||
| Pink | |||||
| Yellow |
Specificity
| Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Purple | |||||
| Red | |||||
| Orange | |||||
| Blue |
W/F section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
| Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Specificity
| Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |