BME103:T930 Group 2 l2: Difference between revisions
No edit summary |
No edit summary |
||
| Line 137: | Line 137: | ||
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836 | http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836 | ||
''Disease Description'' | |||
Sickle cell anemia is an inherited blood disorder characterized primarily by chronic anemia and periodic episodes of pain. The underlying problem involves hemoglobin, a component of red blood cells. Hemoglobin molecules in each red blood cell carry oxygen from the lungs to body organs and tissues and bring carbon dioxide back to the lungs. | |||
In sickle cell anemia, the hemoglobin is defective. After hemoglobin molecules give up their oxygen, some may cluster together and form long, rod-like structures. These structures cause red blood cells to become stiff and assume a sickle shape. | |||
Unlike normal red cells, which are usually smooth and donut-shaped, sickled red cells cannot squeeze through small blood vessels. Instead, they stack up and cause blockages that deprive organs and tissues of oxygen-carrying blood. This process produces periodic episodes of pain and ultimately can damage tissues and vital organs and lead to other serious medical problems. Normal red blood cells live about 120 days in the bloodstream, but sickled red cells die after about 10 to 20 days. Because they cannot be replaced fast enough, the blood is chronically short of red blood cells, a condition called anemia. | |||
''Inheritance'' | |||
Sickle cell anemia is an autosomal recessive genetic disorder caused by a defect in the HBB gene, which codes for hemoglobin. The presence of two defective genes (SS) is needed for sickle cell anemia. If each parent carries one sickle hemoglobin gene (S) and one normal gene (A), each child has a 25% chance of inheriting two defective genes and having sickle cell anemia; a 25% chance of inheriting two normal genes and not having the disease; and a 50% chance of being an unaffected carrier like the parents. | |||
Source: http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/sca.shtml | |||
| Line 155: | Line 171: | ||
''rs34430836 [Homo sapiens]'' | ''rs34430836 [Homo sapiens]'' | ||
Primer--ATCACTACCGGACCGAGTGGA | |||
Reverse Primer--TAGTGATGGCCTGGCTCACCT | |||
Revision as of 04:27, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers
rs35685286 [Homo sapiens] GGATGAAGTTGGTGGT--GAGGCCCTGG[A/G]CAGGTTGGTA--TCAAGGTTACAAGAC Chromosome 11- single nucleotide variation http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286
rs34430836 [Homo sapiens] AGGTGCTAGGTGCCTT--TAGTGATGGC[C/G]TGGCTCACCT--GGACAACCTCAAGGG Chromosome 11- single nucleotide variation http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=34430836
Sickle cell anemia is an inherited blood disorder characterized primarily by chronic anemia and periodic episodes of pain. The underlying problem involves hemoglobin, a component of red blood cells. Hemoglobin molecules in each red blood cell carry oxygen from the lungs to body organs and tissues and bring carbon dioxide back to the lungs. In sickle cell anemia, the hemoglobin is defective. After hemoglobin molecules give up their oxygen, some may cluster together and form long, rod-like structures. These structures cause red blood cells to become stiff and assume a sickle shape. Unlike normal red cells, which are usually smooth and donut-shaped, sickled red cells cannot squeeze through small blood vessels. Instead, they stack up and cause blockages that deprive organs and tissues of oxygen-carrying blood. This process produces periodic episodes of pain and ultimately can damage tissues and vital organs and lead to other serious medical problems. Normal red blood cells live about 120 days in the bloodstream, but sickled red cells die after about 10 to 20 days. Because they cannot be replaced fast enough, the blood is chronically short of red blood cells, a condition called anemia.
Sickle cell anemia is an autosomal recessive genetic disorder caused by a defect in the HBB gene, which codes for hemoglobin. The presence of two defective genes (SS) is needed for sickle cell anemia. If each parent carries one sickle hemoglobin gene (S) and one normal gene (A), each child has a 25% chance of inheriting two defective genes and having sickle cell anemia; a 25% chance of inheriting two normal genes and not having the disease; and a 50% chance of being an unaffected carrier like the parents. Source: http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/sca.shtml
rs35685286 [Homo sapiens] Primer--CTCCGGGACCTGTCCAACCAT Reverse Primer-- GAGGCCCTGGACAGGTTGGTA
rs34430836 [Homo sapiens] Primer--ATCACTACCGGACCGAGTGGA Reverse Primer--TAGTGATGGCCTGGCTCACCT
| ||||||||||||||||||||||||||||||||||||||


