840:153g:Projects/project3/2009/01/27

Tear Inducing Bacteria

Main project page Next entry

Tuesday January 27, 2009 Today's agenda: - Fix errors and holes in proposal. - Double check primers. - Find a protocol for DNA extraction from onions. - Plan Thursday's lab. During today's lab our team was able to double check the proposal and to find answers to any unknown questions. One big problem was the primers. It was a big debate if the primers given to us in the article we found were going to work so we just decided to design our own. Once that was taken care of we found a protocol for DNA extraction. Our plan for Thursday is to review this protocol and prepare to be ready to start right away next Tuesday. The gene specific oligonucleotide primer sets we designed ourselves: * Signal Peptide: 5’- gaattcgcggccgcttctag atggagtcttaccacaaagt -3’ * Mature Peptide: 5’- gaattcgcggccgcttctag atg aaggtgacatggagtttgaa -3’ * 3' UTR Stop Signal: 5'- ctgcagcggccgctactagta ttaaatgaaaggacggcggg-3'