840:153g:Projects/project3/2009/01/29

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Tear Inducing Bacteria Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Thursday January 29, 2009

  • Today our group read over the DNA extraction protocol and prepared the solutions and buffers for lab next Tuesday. We also fixed one of our primers.
  • The primer was changed to the following:
   3' UTR Stop Signal: 5'- ctgcagcggccgctactagta ttaaatgaaaggacggcggg-3'