840:153g:Projects/project2/2008/09/25

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png The sweet smell of ...E.coli? Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

The Sweet Smell of.....E.coli?

Cory and Matt did a tranformation again on the competent cells we made since the cells didn't take up any of our Plasmids. They did the tranformation with pBlue script cells to check if our cells were competent. They transformed them and put them on Amp. plates to grow. They also did some control plates to check our E coli cell to see if they are alive. They also used some known competent cells and used our trandformation method to see if the tranformation method my have been the problem Surabhi, Jared, Diveena, and Aaron developed some primers on the IDT website. We used primer quest in the SciTool. The results of out work are shown below. The primers that we developed will be ordered over the next few days so they are ready for us next week.


Part-only sequence for BBa_J45120(1292 bp)

tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatggaagttgttgaagttc ttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccat gattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgtt aaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttc agtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagact tttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttac atggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatga aaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaa taagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgag aaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgca tgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtc caaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaaga ctgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

Wintergreen – forward and reverse primer #1

Forward Primer Sequence: ACTACTAGAGTCACACAGGAAAGTA

Primer Start Position: 53 Primer Length: 25 Primer TM: 54.2 ºC Primer Self Any: 6.0 Primer GC %: 40.0 % Primer Self End: 2.0 Primer End Stability: 4.30 Primer Penalty: 16.75



Reverse Primer Sequence: TCTAGTAGAGAGCGTTCACCGACAA

Primer Start Position: 1250 Primer Length: 25 Primer TM: 58.6 ºC Primer Self Any: 7.0 Primer GC %: 48.0 % Primer Self End: 2.0 Primer End Stability: 5.19 Primer Penalty: 4.39


Forward primer 1 will have restriction site Xba1 added (TCTAGA)with 4 random nucleotides added for the sequence of AACATCTAGA Reverse primer 1 will have restriction site Spe1 added (ACTAGT) with 4 random nucleotides added for the sequence of TAATACTAGT

For a total forward primer 1 of AACATCTAGAACTACTAGAGTCACACAGGAAAGTA For a total reverse primer 1 of TAATACTAGTTCTAGTAGAGAGCGTTCACCGACAA


tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatggaagttgttgaagttc ttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccat gattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgtt aaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttc agtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagact tttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttac atggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatga aaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaa taagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgag aaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgca tgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtc caaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaaga ctgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

Wintergreen -- forward and reverse primer #2 Forward Primer Sequence: TGAGCACTACTAGAGTCACACAGG Primer Start Position: 48 Primer Length: 24 Primer TM: 57.3 ºC Primer Self Any: 7.0 Primer GC %: 50.0 % Primer Self End: 1.0 Primer End Stability: 6.01 Primer Penalty: 2.69


Reverse Primer Sequence: AGTAGAGAGCGTTCACCGACAAAC Primer Start Position: 1247 Primer Length: 24 Primer TM: 58.5 ºC Primer Self Any: 4.0 Primer GC %: 50.0 % Primer Self End: 2.0 Primer End Stability: 4.89 Primer Penalty: 1.53


Forward primer 2 will have restriction site Xba1 added (TCTAGA) with 4 random nucleotides added for the sequence of TAATTCTAGA Reverse primer 2 will have restriction site Pst1 added (CTGCAG) with 4 random nucleotides added for the sequence of TAATCTGCAG


For a total forward primer 2 of TAATTCTAGATGAGCACTACTAGAGTCACACAGG For a total reverse primer 2 of TAATCTGCAGAGTAGAGAGCGTTCACCGACAAAC