20.109(F08): The grafting parlour
NOTES FROM 11.11 meeting with the artist from THE GRAFTING PARLOUR
Please edit and add information that I didn't capture
Nkuldell 16:39, 11 November 2008 (EST)
Initial themes
- Form brings questions about content
- Computational approaches represent nature but biology holds in itself the reality of nature
- Art can tilt and sway perspective
- Interactive technology (video, telecommunication) are time base media
Framing questions
- How to look at the world through nature’s point of view?
- How can artwork change itself during a show?
- How can artwork change as it travels from gallery to gallery?
- We value the history of an object but can an object have traces/memories of itself and its history?
- Is the human desire to “fix time” immutable?
- We think of our cells as making up us but they have a life of their own as well (circadian pulsing of neurons every 23.5 hours w/o stimulus). What is the biological memory that cells have of a day? What do cells have to say to us?
- Galleries usually carefully manage light/moisture/temperature to inhibit bacteria growth on art but is this just a romantic notion of art by masters and is the intervention needed? Can unpredictable evolution/passage/change of art be part of art?
Art/Science examples we considered
- Eduardo Kac
- Transgenetic Alba bunny: use of animals as art? Research was done for science then made accessible through art
- Specimen of Secrecy About Marvelous Discoveries, pt 1
- Specimen of Secrecy About Marvelous Discoveries, pt2
- Hyunkoo Lee: animatus= skeletons from animated characters. Notable for its performance of science, that the artist makes apparent. Some eerie some playful examples.
NOTES: about microscope/display
from Lucy 12.08.08
- There are ways to convert a webcam into a microscope [1] but my guess is that the magnification is not great.
- Whether microscope or document camera, it depends on how wide a view will be captured. Here is
one that works with existing analog microscopes: [2]
- And here is more information on the document camera that I've been looking
at: [3]
G1 to S transition
Primers to check Cln1:GFP and Cln2:GFP strains
From intro of Fred Cross paper on Clb2: "Cyclins and cyclin-dependent kinase (Cdk) provide excellent candidates for a central controlling timer. In all eukaryotes, mitotic cyclin–Cdk activity rises and falls once per division. Mitotic cyclins (CLB1, 2, 3, and 4 in S. cerevisiae) are required for mitotic entry (spindle assembly and anaphase). However, overexpression of mitotic cyclin prevents mitotic exit (spindle disassembly and cytokinesis), resulting in telophase arrest (Surana et al, 1993 PMID: 8491189)." So perhaps a system in which CLN1:GFP fusion is controlled on a plasmid and is Gal inducible might arrest at S?
Cln1= 1641bp


NO270=Forward: CCCT TTTCTCTCTATGCCCAT
- length = 21
- Tm = 54.3
- GC = 47.6
NO271=Reverse: CTAG ATGTTTGTAGGTGGGCA
- length = 21
- Tm = 54.3
- GC = 47.6
PCR product = 977bp
PCR product+GFP = 1690bp
Cln2 = 1638 bp


NO272= Forward: CACGGCATATTCTCCATTATC
- length: 21
- Tm = 50.9
- GC = 42.9
NO273= Reverse: GGTCTCTTTTTGGTACGTTTG
- length = 21
- Tm = 51.8
- GC = 42.9
PCR product = 804bp
PCR product+GFP = 1517bp
Additional Primers
| NO# | Name | Seq | Length, adds | Tm | G/C |
|---|---|---|---|---|---|
| NO274 | CLN1_2GFP_-900fwd | CATTAG GCCGGC ACAGCATTC CCTTGTTCGC AACACTT | 26, Random NaeI cln1 ~900bp before | 63.4 | 46.2 |
| NO275 | CLN1_2GFP_rev | CATTAG GGATCC CAGTTGA GAGCTATTGT GGTTCCTTA | 26, Random BamHI cln1 | 63.0 | 42.3 |
| NO276 | CLN2_2GFP_-300forward | CATTAG GGTACC GCAGCC TCTGGCTACT TGTTTAACTT | 26, Random KpnI cln2 ~300 bp before | 63.4 | 46.2 |
| NO277 | CLN2_2GFP_rev | CATTAG GGATCC TACTTGGGTA TTGCCCATACCA AAAG | 26, Random BamHI cln2 | 63 | 42.3 |
| NO278 | CLN+GFP_rev | CATTAG GCATGC TCACTTGTTCAATAGGCCTATGCCAT | 29, Random SphI GFP | 63.4 | 46.2 |