User:Saroj Pandey/Notebook/SNP PCR optimization/2014/10/06

Project name

Main project page Previous entry      Next entry

gradient PCR for optimization • Correct primer combinations from previous result were again used for a gradient PCR to find out the optimal annealing temperature gradient PCR electrophoresis electrophoresis Primers 1. Product size: 510bp [gaF + Gfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC 2. Product size: 510bp [gaF + Cfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGG 3. Product size: 235bp [Cfb(F) + Gfb(R)] Cfb(F): GGTGGCAACCAGGTCTTTAG Gfb(R): CAATCACTGTTGCTCAGTGC 4. Product size: 235bp [Cfb(F) + Cfb(R)] Cfb(F): GGTGGCAACCAGGTCTTTAG Cfb(R): CAATCACTGTTGCTCAGTGG Observation • Taster [gaF + Cfb(R)]: Expected products were seen at different temperatures except 58.1°C and 56.4°C where bands were seen at 100bp. A faint band was seen at 68°C which was not observed at 69°C. • Non-taster [gaF + Gfb(R)]: Expected product size of 510bp was seen at temperatures 66.3°C and below and not observed above it. • Taster [Cfb(F) + Cfb(R)] and Non-taster [Cfb(F) + Gfb(R)]:: Expected product size of 235bp was seen from 55.5°C to 63.7°C and became fainter above it. All the reactions, including blanks, have side products below 100bp which might be primer dimers. Conclusion • The optimal annealing temperature for all four reactions seems to be 60.5°C.