User:Saroj Pandey/Notebook/SNP PCR optimization/2014/10/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

PCR with different primer combinations

• Genomic DNAs were used as templates to amplify different regions of DNA including the taste SNP

PCR program
PCR program
Electrophoresis
Electrophoresis

Primer combinations

1. Product size: 510bp [gaF + Gfb(R)]

gaF: ATCCGTGATGCTGTGCTATG

Gfb(R): CAATCACTGTTGCTCAGTGC

2. Product size: 510bp [gaF + Cfb(R)]

gaF: ATCCGTGATGCTGTGCTATG

Gfb(R): CAATCACTGTTGCTCAGTGG

3. Product size: 522bp [Gff(F) + gaR]

Gff(F): GGGATGTAGTGAAGAGGCAGG

gaR: GCATCCCAGAAGAAACCAGA

4. Product size: 522bp [Cff(F) + gaR]

Gff(F): GGGATGTAGTGAAGAGGCAGC

gaR: GCATCCCAGAAGAAACCAGA

5. Product size: 235bp [Cfb(F) + Gfb(R)]

Cfb(F): GGTGGCAACCAGGTCTTTAG

Gfb(R): CAATCACTGTTGCTCAGTGC

6. Product size: 235bp [Cfb(F) + Cfb(R)]

Cfb(F): GGTGGCAACCAGGTCTTTAG

Cfb(R): CAATCACTGTTGCTCAGTGG

7. Product size: 161bp [Gff(F) + Cff(R)]

Gff(F): GGGATGTAGTGAAGAGGCAGG

Cff(R): GATGGCTTGGTAGCTGTGGT

8. Product size: 161bp [Cff(F) + Cff(R)]

Cff(F): GGGATGTAGTGAAGAGGCAGC

Cff(R): GATGGCTTGGTAGCTGTGGT



Observation

• [gaF+Gfb(R) and gaF+Cfb(R)] : Allele specific reverse primers showed bands with the corresponding templates just above 500bp.

• [Gff(F)+gaR and Cff(F)+gaR] : Allele specific forward primer produced an expected specific band only with non-taster template but not with the taster one. Rather a thick bright band was seen at 100bp with taster template.

• [Cfb(F)+Gfb(R) and Cfb(F)+Cfb(R)] : Allele specific reverse primers also worked with a different forward primer producing shorter bands (235bp)

• [Gff(F)+Cff(R) and Cff(F)+Cff(R)] : Allele specific forward primers produced similar bands with both templates and were unable to distinguish between the two.


Conclusion

• Allele specific reverse primers when combined with a non-specific common forward primer are able to differentiate the SNPs.

• There might have been pipetting error for different results seen with allele specific forward primers or they might not be the right primers to differentiate the taste SNPs.



Personal tools