User:Joana Vieira Fernandes/Notebook/Joana Fernandes/2010/03/09

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Gene e mRNA

A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA


  • Que diferenças encontra e qual a sua origem?

A sequência correspondente ao mRNA da beta-globina possui um alinhamento significativo com o DNA do gene da beta-globina. Contudo, na sequência correspondente ao mRNA da beta-globina já não estão presentes os intrões.

  • Onde se inicia a transcrição e porquê?

A transcrição começa no inicio da sequência indicada ACATTTGCTTCTGACACAA no gene, que corresponde a uma sequência idêntica no mRNA. A (T)ATAAA box está localizada a -30 pares de bases, e corresponde à sequência onde se dá o inicio da ligação dos factores de transcrição que vão depois recrutar a polimerase II.


  • Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica?

Convencionou-se o sentido 5' - 3', e, para cada sequência, obteve-se 3 frames nesse sentido. Por observação, no caso do DNA, verifica-se a presença de um caos genómico, devido à presença de muitos codões stop, e pequenas sequências entre esses mesmos codões e a metionina (Met). Por esse motivo, não é possível identificar a proteína (os intrões ainda estão presentes).


No caso do mRNA, os melhores frames são:

  1. 5'3' Frame 3

I C F Stop H N C V H Stop Q P Q T D T Met V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H Stop A R F L A V Q F L L K V P L F P K S N Y Stop T G G Y Y E G P Stop A S G F C L I K N I Y F H C K K K K

  1. 3'5' Frame 3

F F F L Q Stop K Stop Met F F I R Q N P D A Q G P S Stop Y P P V Stop Stop L D L G N K G T F N R N W T A R K R A Stop Stop Y L W A R A L A T P A T T F Stop Stop A A C T G G V N S L P K Stop W A S T Q T S T L P R S L K F S G S T C S L S Q C S S L S V A K V P L R L S R Stop A R P S L K A P S T F L P Stop A F T L G L P I T A S G V D R S P K D S K N L W V Q G Stop T T S S L P R A S P P T S S T F T L P H R A V T A D F S S G V R C T Met V S V Stop G C Stop Stop T Q L C Q K Q Met


Neste caso, os intrões já estão ausentes e as sequências entre metionina (Met) e os codões stop são mais longas, o que já permite a identificação de proteínas.


  • Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)?

No caso das bactérias, estas não sofrem splicing, ao contrário das leveduras, que já removem alguns dos intrões. Assim, o transcrito nas bactérias é muito longo (integral), enquanto que nas leveduras já se obtém um transcrito mais pequeno.


  • As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração?

As bactérias não conseguem processar o genoma humano, devido ao facto de este conter intrões (ausentes nas bactérias e promotores diferentes. Para se produzir uma proteína humana, e uma vez que o mRNA (onde os intrões estão ausentes) é muito instável, é necessário produzir cDNA, a partir deste mRNA com promotores característicos das bactérias, para que estas possam, então, processar essa informação.

Personal tools