Search results
From OpenWetWare
Jump to navigationJump to search
Did you mean: edge
- Spring 2020 Biology 478: Molecular Biology of the Genome course Edge Software Protocol Edge Manual (Note: I posted this because I could no longer find a link...20 KB (1,600 words) - 12:39, 16 January 2024
- 90682.2008 | PubMed ID:18753324 | HubMed [LinaresHolcombe2008neurophys] Kanai R, Sheth BR, and Shimojo S. Stopping the motion and sleuthing the flash-lag effect:...15 KB (3,286 words) - 11:59, 22 March 2024
- Mannhold R, Kubinyi H, Timmerman H (Editors), Bioinformatics - From Genomes to Drugs Vol.I & II, Wiley - VCH, 2002 ISBN: 3527299882 Flower, D R (Editor)...1 KB (156 words) - 05:18, 7 March 2006
- brilliant blue, R-250" makes a deep purple color with high contrast. The "G-250" type makes a softer blue with less contrast. We prefer the R-250. Old: 0.2-0...17 KB (2,987 words) - 09:24, 14 June 2022
- Matia-González, A.M., Imig, J., Zheng, X., Xiong, L., Gisler, P., Eberhard, R., Holtackers, R., Gerber, A.P., Pelkmans, L., Hengartner M.O. (2016) Post-transcriptional...14 KB (10 words) - 07:08, 22 September 2023
- Rogers, J. A.; Nuzzo, R. G. materialstoday 2005, 1–7. DOI: 10.1016/S1369-7021(05)00702-9 4. McDonald, J. C.; Duffy, D. C.; Anderson, J. R.; Chiu, D. T.; Wu...10 KB (1,284 words) - 15:15, 26 March 2023
- (49). DOI: h10.1088/0957-4484/23/49/495501 4. Helmuth, J.; Schmid, H.; Stutz, R.; Stemmer, A.; Wolf, H. High-Speed Microcontact Printing. J. Am. Chem. Soc...14 KB (1,723 words) - 18:41, 2 May 2022
- 82030-992 (did 8 before) Primer PBB-ior-R - tttgcaagcagcagattacg Primer PBB-ior-F - tgaccaaaatcccttaacgtg Primer PBB-eoro-R - gctgaagccagttaccttcg Primer PBB-eoro-F...50 KB (7,645 words) - 08:59, 11 August 2011
- propensity). r2a = random.random()*a a_sum = 0 for i in a_i: if r2a < (a_i[i]+a_sum): mu = i break a_sum += a_i[i] Where a_sum is the "right edge" of the current...2 KB (350 words) - 11:19, 8 December 2006
- • Projects • People • Social service • We R in the News • A science treat • Science is awesome! • Cutting-edge science • Courses • Wisdom in wise words...4 KB (23 words) - 15:33, 31 August 2022
- Kaul R, Raymond C, Shimizu N, Kawasaki K, Minoshima S, Evans GA, Athanasiou M, Schultz R, Roe BA, Chen F, Pan H, Ramser J, Lehrach H, Reinhardt R, McCombie...28 KB (10,046 words) - 04:37, 26 October 2023
- Meetings Cancer Journal Club Cell/CANB 616 Gen. Inst/R3 Club CANB 610 Cross-departmental journal club composed of students...4 KB (221 words) - 09:23, 22 May 2018
- folder full of 2D fids. There will be as many files here as there are complex (R+I) points on your z-axis (usually 15N): Process & phase the first plane. You...14 KB (1,955 words) - 15:56, 2 January 2006
- Functional Network Composition Thursday Mar 11 Media:EdgeDetection fromHelenChen.pdf A synthetic genetic edge detection program Tabor JJ et al. Cell (2009) 137(7):1272-81...11 KB (39 words) - 08:03, 12 May 2010
- reagent. Wick away all residual chemiluminescent liquid by dabbing membrane edges on paper towel. Prepare the membranes for ECL by covering with either saran...19 KB (2,668 words) - 11:43, 1 March 2021
- into direct contact with the mixing bar become mixed. Liquid at the very edges of the channel continue to rely purely on diffusion for mixing. Figure 2...7 KB (985 words) - 08:33, 20 February 2023
- Lab on a Chip 2012, 12 (6), 1078 DOI: 10.1039/c2lc21133e. 6-Mohan, R.; Schudel, B. R.; Desai, A. V.; Yearsley, J. D.; Apblett, C. A.; Kenis, P. J. Design...24 KB (3,249 words) - 10:36, 12 May 2019
- present in the R package igraph. To download this package, complete the following steps: Run the software R. Type the following into the R command line and...2 KB (319 words) - 13:08, 9 March 2016
- Choose Terminal. Type: cd Desktop/edge_1.1.290 R At this point, the R prompt shows up. Type: source("edge.r") edge() The Edge GUI should now appear. Create...2 KB (362 words) - 11:40, 14 October 2008
- Engineering Chemistry Research 48: 6441-6447. Sathitsuksanoh N., Yang H.Y., Cahela D.R., and Tatarchuk B.J. 2007 Immobilization of CO2 by Aqueous K2CO3 Using Microfibrous...3 KB (8 words) - 09:20, 11 June 2013
