Search results

From OpenWetWare
Jump to navigationJump to search
Did you mean: east
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)
  • A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...
    19 KB (1,891 words) - 20:41, 21 May 2010
  • from the publisher if appropriate. Note: †co-first, * corresponding AHT-ChIP-seq: a completely automated robotic protocol for high-throughput chromatin immunoprecipitation...
    13 KB (698 words) - 20:22, 9 November 2013
  • A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...
    19 KB (1,891 words) - 20:22, 21 May 2010
  • Hilhorst, W Ligterink. “Construction of a High-Density Genetic Map from RNA-Seq Data for an Arabidopsis Bay-0 × Shahdara RIL Population” Frontiers in Plant...
    11 KB (1,157 words) - 19:44, 6 May 2018
  • Nussbaum C, Myers RM, Brown M, Li W#, Liu XS#: Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 9 (2008) R137 (# joint corresponding authors). Full Article...
    17 KB (1,742 words) - 19:29, 20 May 2010
  • Grant, G., Hogenesch, J.B., Hughes, M.E. (2015). Considerations for RNA-seq analysis of circadian rhythms. Methods in Enzymology. doi: 10.1016/bs.mie...
    8 KB (1,166 words) - 22:46, 18 January 2018
  • Zhang Y, Liu XS: CistromeMap: a knowledgebase and web server for ChIP-Seq and DNase-Seq studies in mouse and human. Bioinformatics 28 (2012) 1411-1412. Xiao...
    55 KB (7,535 words) - 21:26, 13 July 2020
  • Wang Q, Bresnick EH, Farnham PJ, Jin VX (2012) “Integration of Hi-C and ChIP-seq data reveals distinct types of chromatin linkages” Nucleic Acids Res 40(16):7690-7704...
    17 KB (25 words) - 16:02, 1 July 2016
  • gccgctacagggcgcgtc not sure if ef1a is inserted revcomp relative to this seq Hey Tim this is Christoph. It IS inserted revcomp relative to this sequence...
    8 KB (464 words) - 00:51, 20 July 2010
  • <teacher ONs in light and dark> Day 5: DNA for seq, and b-gal assay Day 6: Protein gel and blot, seq data, photo?, other assays Day 7: Probe blot, other...
    9 KB (1,004 words) - 16:02, 15 September 2012
  • /usr/bin/env python # Hetmann Hsieh # Assignment 1 # 2/6/07 from Bio import GenBank, Seq # We can create a GenBank object that will parse a raw record # This facilitates...
    15 KB (1,464 words) - 20:33, 8 February 2007
  • CCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAAT; https://benchling.com/s/seq-eaRmq6aHEQcqsjsegdT5...
    10 KB (109 words) - 20:17, 24 February 2020
  • A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...
    19 KB (1,891 words) - 20:23, 21 May 2010
  • A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...
    19 KB (1,891 words) - 20:44, 21 May 2010
  • A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...
    19 KB (1,891 words) - 20:24, 19 May 2010
  • Nussbaum C, Myers RM, Brown M, Li W#, Liu XS#: Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 9 (2008) R137 (# joint corresponding authors). Full Article...
    17 KB (1,742 words) - 20:08, 17 October 2009
  • A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...
    19 KB (1,891 words) - 14:31, 14 May 2010
  • Code: #!/usr/bin/env python from Bio import GenBank, Seq # We can create a GenBank object that will parse a raw record # This facilitates extracting specific...
    15 KB (1,617 words) - 12:12, 8 February 2007
  • Jin about 2017 transform jtk159 with 2017 Submit 2345 in pmll vector for seq off tetR too Ligated (9:30pm) and Transformed (jtk159) to assemble the following...
    117 KB (12,181 words) - 04:29, 14 October 2010
  • transfer over again. To do: Minipreps Ask Tim about Ef1a sequence. 30µL into ea mL TB media (use TB for growing up for assay) Submitted a sample a for each...
    65 KB (6,785 words) - 00:52, 13 August 2010
View (previous 20 | ) (20 | 50 | 100 | 250 | 500)