Search results
From OpenWetWare
Jump to navigationJump to search
Did you mean: east
- <teacher ONs in light and dark> Day 5: DNA for seq, and b-gal assay Day 6: Protein gel and blot, seq data, photo?, other assays Day 7: Probe blot, other...9 KB (1,004 words) - 09:02, 15 September 2012
- CCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAAT; https://benchling.com/s/seq-eaRmq6aHEQcqsjsegdT5...10 KB (109 words) - 13:17, 24 February 2020
- from the publisher if appropriate. Note: †co-first, * corresponding AHT-ChIP-seq: a completely automated robotic protocol for high-throughput chromatin immunoprecipitation...13 KB (698 words) - 13:22, 9 November 2013
- Nussbaum C, Myers RM, Brown M, Li W#, Liu XS#: Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 9 (2008) R137 (# joint corresponding authors). Full Article...17 KB (1,742 words) - 12:29, 20 May 2010
- A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...19 KB (1,891 words) - 13:23, 21 May 2010
- A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...19 KB (1,891 words) - 07:31, 14 May 2010
- A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...19 KB (1,891 words) - 13:24, 19 May 2010
- A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...19 KB (1,891 words) - 13:41, 21 May 2010
- A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...19 KB (1,891 words) - 13:44, 21 May 2010
- Nussbaum C, Myers RM, Brown M, Li W#, Liu XS#: Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 9 (2008) R137 (# joint corresponding authors). Full Article...17 KB (1,742 words) - 13:08, 17 October 2009
- A Statistical Method for the Detection of Alternative Splicing using RNA-seq. ** PLoS ONE 5 (2010) e8529.Full Article Highlighted in This Week in PLoS...19 KB (1,891 words) - 13:22, 21 May 2010
- p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover { color: #eb8300;...20 KB (2,404 words) - 22:02, 27 October 2012
- $('#headover ul li a[href$="' + path + '"]').addClass("curlink").css("color","#ea8828");; var vCurlink = $('#headover ul li a[href$="' + path + '"]').attr("id");...15 KB (1,739 words) - 09:12, 23 September 2010
- gccgctacagggcgcgtc not sure if ef1a is inserted revcomp relative to this seq Hey Tim this is Christoph. It IS inserted revcomp relative to this sequence...8 KB (464 words) - 17:51, 19 July 2010
- Hilhorst, W Ligterink. “Construction of a High-Density Genetic Map from RNA-Seq Data for an Arabidopsis Bay-0 × Shahdara RIL Population” Frontiers in Plant...11 KB (1,157 words) - 12:44, 6 May 2018
- Zhang Y, Liu XS: CistromeMap: a knowledgebase and web server for ChIP-Seq and DNase-Seq studies in mouse and human. Bioinformatics 28 (2012) 1411-1412. Xiao...55 KB (7,535 words) - 14:26, 13 July 2020
- Wang Q, Bresnick EH, Farnham PJ, Jin VX (2012) “Integration of Hi-C and ChIP-seq data reveals distinct types of chromatin linkages” Nucleic Acids Res 40(16):7690-7704...17 KB (25 words) - 09:02, 1 July 2016
- Jin about 2017 transform jtk159 with 2017 Submit 2345 in pmll vector for seq off tetR too Ligated (9:30pm) and Transformed (jtk159) to assemble the following...117 KB (12,180 words) - 21:29, 13 October 2010
- transfer over again. To do: Minipreps Ask Tim about Ef1a sequence. 30µL into ea mL TB media (use TB for growing up for assay) Submitted a sample a for each...65 KB (6,784 words) - 17:52, 12 August 2010
- tmMf3cBfzKNz8yy+b2Kx6nqH9LnBwInzrfDvSAEfEE+Yu7HDbUZM9EvofmkFVBUmeq0zQ9gE9kEA0RVTxl0H4Ku06kZucpEP43dn62q3+VTtvb7eTRo8hiEeaOq5Swit6qUNfitqlqes6Nt4ZpMuIP...299 KB (0 words) - 23:30, 26 September 2017
