20.109: 2-component signaling

From OpenWetWare

Jump to: navigation, search

Contents

Module for F'12

Mutagenesis of T541

Oligos for screen

  • NO304: K+P- screen of T541, mutagenesis oligo:

5'--CTG GCG GAT GAC CGC ACG CTG CTG ATG GCG GGG GTA AGT CAC GAC TTG CGC NNY CCG CTG ACG CGT ATT CGC CTG GCG ACT GAG ATG ATG -3'

  • NO305: complementary oligo that binds to 3' end of mutagenic oligo and builds plasmid around the horn:

5'- CAT CAT CTC AGT CGC CAG GCG AAT ACG CGT CAG -3'

Module for F'11

  • Remade reporter strain NB462 and tested for induction--using antibiotics at: Amp25, Cam34, Kan10, and including Kan10 always.
  • Remade library K+P- and K-P+. Used H557A as control for K-P+ screen
  • Retested indicator media. Phenol red failed, but Z4 gave clear colonies in dark and red colonies in light (except where dense).

Students will try to identify K-P+ mutants that appear more red in light, i.e. lower units in light, then check to see if dynamic range improved or if all activity diminished

  • Day 1: set up dark/light system in plates, liq culture
  • Day 2: b-gal assay of cultures, set up photo
  • Day 3: transform library and screen, recapitulate setup electronically
  • Day 4: Journal club I, re-streak candidate, <teacher ONs in light and dark>
  • Day 5: DNA for seq, and b-gal assay
  • Day 6: Protein gel and blot, seq data, photo?, other assays
  • Day 7: Probe blot, other assays
  • Day 8: Journal club, data back

Oligos ordered for F'11 screen

  • NO294: K-P+ library, mutagenesis of A553:

5'- CAT ATG GCG GCT GGT GTT AAG CAA CTG GCG GAT GAC CGC ACG CTG CTG ATG RNS GGG GTA AGT CAC GAC TTG CGC ACG CCG CTG ACG CGT -3'

  • NO295: K-P+ control, mutagenesis of H557A (CAC to GCC)

5'- T GAC CGC ACG CTG CTG ATG GCG GGG GTA AGT GCC GAC TTG CGC ACG CCG CTG ACG CGT -3'

  • NO296: fwd seq primer, starts at ~3500 in pCph8

5'- TCG TCA ACC TCA TTT TGC GCC AG -3'

  • 23 mer, Tm = 60.3 ºC
  • NO297: fwd seq primer, start just upstream of Cph8 promoter

5' TCATGACATTAACCTATAAAAATAGGCGTATCACG

  • in map bp 1860-1894
  • 35mer, Tm 58.2°C

Useful links

Useful Images and Files

Coliroid Signaling
Coliroid Signaling

Coliroid example
Coliroid example

plasmid map of pCph8, file is  here
plasmid map of pCph8, file is here

pCph8 cut sites, zero-cutters in red
pCph8 cut sites, zero-cutters in red

References

  • Synthetic biology: engineering Escherichia coli to see light. Levskaya A, Chevalier AA, Tabor JJ, Simpson ZB, Lavery LA, Levy M, Davidson EA, Scouras A, Ellington AD, Marcotte EM, Voigt CA.

Nature. 2005 Nov 24;438(7067):441-2. PMID: 16306980 and pdf

  • Engineered single- and multi-cell chemotaxis pathways in E. coli. Goldberg SD, Derr P, DeGrado WF, Goulian M. Mol Syst Biol. 2009;5:283. Epub 2009 Jun 16. PMID: 19536206 and pdf
  • Specificity in two-component signal transduction pathways. Laub MT, Goulian M. Annu Rev Genet. 2007;41:121-45. Review. PMID: 18076326 and pdf
  • Mutations that alter the kinase and phosphatase activities of the two-component sensor EnvZ. Hsing W, Russo FD, Bernd KK, Silhavy TJ. J Bacteriol. 1998 Sep;180(17):4538-46. PMID: 9721293 and pdf
  • Cross-talk suppression between the CpxA-CpxR and EnvZ-OmpR two-component systems in E. coli. Siryaporn A, Goulian M. Mol Microbiol. 2008 Oct;70(2):494-506. Epub 2008 Aug 29. PMID: 18761686 and pdf
  • Design and signaling mechanism of light-regulated histidine kinases. Möglich A, Ayers RA, Moffat K. J Mol Biol. 2009 Feb 6;385(5):1433-44. Epub 2008 Dec 14. PMID: 19109976 and pdf
  • EnvZ-OmpR interaction and osmoregulation in Escherichia coli. Cai SJ, Inouye M. J Biol Chem. 2002 Jul 5;277(27):24155-61. Epub 2002 Apr 24. PMID: 11973328 and pdf

K-P+ and K+P- mutations

06.16.09 email from Mike: As for the EnvZ mutants, here's the list we've compiled from the literature. Keep in mind that K+P- really means a shift in the balance of kinase and phosphatase activities and similarly for the K-P+ alleles. None of them is perfectly "clean" in eliminating one of the activities:

K+P-

  • V241G = V555G in Cph8
  • G240E = G554E in Cph8
  • S242D = S556D in Cph8
  • P248Q
  • T247R
  • Q283P
  • Y287D
  • L288P

K-P+

  • A239T = A553 in Cph8
  • N343K
  • F390L
  • H243A = H557A in Cph8

NK note: relevant reference:

  • Mutations that alter the kinase and phosphatase activities of the two-component sensor EnvZ. Hsing W, Russo FD, Bernd KK, Silhavy TJ. J Bacteriol. 1998 Sep;180(17):4538-46. PMID: 9721293
  • The role of the G2 box, a conserved motif in the histidine kinase superfamily, in modulating the function of EnvZ. Zhu Y, Inouye M. Mol Microbiol. 2002 Aug;45(3):653-63. PMID: 12139613
unique sited in Cph8, clone with Nde at 1546 and Mlu at 1630
unique sited in Cph8, clone with Nde at 1546 and Mlu at 1630
zoom-in seq of region for library
zoom-in seq of region for library

Image:RandomizedKPlibrary.png

Primers

NO281 = KP randomized template

  • 5' CATATGGCGGCTGGTGTTAAGCAACTGGCGGATGACCGCACGCTGCTGATG RNS RNS RNS RNS SNW GACTTGCGCACGCCGCTGACGCGT

NO284 = P+ randomized template

  • 5' CATATGGCGGCTGGTGTTAAGCAACTGGCGGATGACCGCACGCTGCTGATG RNS GGG GTA AGT SNW GACTTGCGCACGCCGCTGACGCGT

NO285 = K+ randomized template

  • 5' CATATGGCGGCTGGTGTTAAGCAACTGGCGGATGACCGCACGCTGCTGATG GCG RNS RNS RNS CAC GACTTGCGCACGCCGCTGACGCGT

NO282 = KPLibrary_fwd_1535_1573

  • 5' CAGAAGAATTGCATATGGCGGCTGGTGTTAAGCAACTGG
    • 39 mer
    • Tm (all) = 66.3 ºC
    • Tm (landing, 28 mer) = 63.3 ºC

NO283 = KPLibrary_rev_1643_1609

  • 5' AGGCGAATACGCGTCAGCGGCGTGCGCAAGT
    • 31 mer
    • Tm (all) = 72.1 ºC
    • Tm (landing, 23 mer) = 70.5 ºC

NO290 = LibraryBuilder_rev

    • 33mer
    • 5' ATC CGC CAG TTG CTT AAC ACC AGC CGC CAT ATG
    • Tm = 67°
    • should hybridize to 5' end of K+ and P+ template oligos (NO284, NO285) to go 'round the horn for library

NO279 = GFPfiller_Nde_fwd
5' CATTAGCATATGGGATCCTAAGAGGGCGAGGGCGATGCCACC

    • 42 mer
    • Tm (all) = 69.7 ºC
    • Tm (landing, 24 mer) = 67 ºC

NO280 = GFPfiller_Mlu_rev
5' CATTAGTGCGCAGATATCTTACTTGTACAGCTCGTCCATGC
corrected: 5' CATTAGACGCGTGATATCTTACTTGTACAGCTCGTCCATGC

    • 41 mer
    • Tm (all) = 64.6 ºC
    • Tm (landing, 23 mer) = 57 ºC

NO288= GFPfiller_Nde_rev
5'CATTAGCATATGGATATCTTACTTGTACAGCTCGTCCATGC

    • Tm (all) = 62.6 ºC
    • Tm (landing, 23 mer) = 57 ºC

NO293= sequencing pCph8 around K+ randomized sequences
5'CTC ATA GCC ACT TTC GGC AGC AAT

    • 21 mer
    • Tm = 60°

Possible ways to epitope tag

Image:CloningEpitopeTags.png All tags at C-terminus, with intention to clone product using unique MfeI and XbaI in pCph8

HA

  • 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
  • reverse translate at |Gene Design with E. coli codon bias
  • default settings gives sequence: TAC CCG TAC GAC GTT CCG GAC TAC GCT

caattgTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTACCCGTACGACGTTCCGGACTACGCTTAAtctaga

to PCR from DNA2.0 vector

  • NO286=HAfrag_fwd
    • 5' GTCGCTGAACAATTGTGCAGCGTATCGTGG
    • Tm = 61.0 ºC
  • NO287=HAfrag_rev
    • 5' GAACTCGATTGACGTCTAGATTAAGCGTAG
    • Tm = 58.1 ºC

to check insert of HA in pCph8

  • NO289 = Cph8+HAseqprimer_bp135_rev
    • 5' ATTACCGCCTTTGAGTGAGC

His6

  • 6 Histidine sequence from pET-45b(+) bp 4963-4980 (Novagen product)

caattgTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGcatcaccaccaccatcacTAAtctaga

Personal tools