BME100 s2016:Group9 W1030AM L4

BME 100 Spring 2016	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Tamara Gajanovic Name: Allison Michael Name: Eduardo Huapaya Name: Bryce Richards Name: Harrison PUffer Name: Maitha Alkatheeri LAB 4 WRITE-UP Protocol Materials a. Lab coat and disposable gloves b. PCR reaction mix, 8 tubes, 50 µL each: Mix contains Taq DNA polymerase, MgCl₂ and dNTP's c. DNA/ primer mix, 8 tubes, 50 µL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer d. A strip of empty PCR tubes e. Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or samples will be cross-contaminated f. Cup for discarded tips g. Micropipettor h. OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G9 + Positive control none G9 - Negative control none G9 1-1 Patient 1, replicate 1 12678 G9 1-2 Patient 1, replicate 2 12678 G9 1-3 Patient 1, replicate 3 12678 G9 2-1 Patient 2, replicate 1 53171 G9 2-2 Patient 2, replicate 2 53171 G9 2-3 Patient 2, replicate 3 53171 DNA Sample Set-up Procedure Step 1: Extract DNA from cells and place it in the special PCR test tube. Step 2: Add Primer 1 to the PCR test tube. The primers will attach to specific sites on the DNA strand. Step 3: Add Primer 2 to the PCR test tube. These primers will attach to the second site. Step 4: Add nucleotides to the PCR test tube. Step 5: Add DNA polymerase into the PCR test tube. Step 6: Put the PCR test tube into the thermal cycler. OpenPCR program HEATED LID: 100 ℃ INITIAL STEP: 95 ℃ for 2 minutes NUMER OF CYLES: 25 Denature at 95 ℃ for 30 seconds, Anneal at 57 ℃ for 30 seconds, and extend at 72 ℃ for 30 seconds FINAL STEP: 72℃ for 2 minutes FINAL HOLD: 4℃ Research and Development PCR - The Underlying Technology The components of PCR Template DNA: This is the sample DNA that you want to duplicate Primers: Primers are attached to the end of the segment of DNA you would like to copy. Tag Polymerase: Act like tiny machines that read the DNA and then attach matching nucleotides to create the DNA copies. Deoxyribonucleotides (dNTP’s): The nucleotide bases added to the growing DNA by the DNA polymerase What happens to the components (listed above) during each step of thermal cycling? Initial Step: 95°C for 3 minutes: Causes the DNA to get ready to be separated to create two single-stranded DN Denature ​at 95°C for 30 seconds: DNA double helix separates to make two single-stranded DNA molecules Anneal​ at 57°C for 30 seconds: This is when primers bind with the single-strand DNA sequence Extend​ at 72°C for 30 seconds: DNA polymerase begin to activate and locate the primer FINAL STEP: 72°C for 3 minutes: It then adds nucleotides to the DNA strand FINAL HOLD: 4°C: You would freeze it, to help the DNA fully anneal What anneals to what? Adenine anneals to Thymine Cytosine anneals to Guanine When does base pairing occur? During the anneal at 57°C, where the primers attach. And also during step two. SNP Information & Primer Design Background: About the Disease SNP SNP's as defined, today, are markers of genetic variation found within the DNA of humans. These variation in DNA bases can warn doctors of disease or lead them to it, and while not all SNP's have direct negative health results, they can be indicative of very much about the body. The SNP examined in this experiment is located on the 19th human chromosome and it associated with the gene B3GNT3. This specific SNP is linked with the disease Non Hodgkin Lymphoma. The disease associated allele contains a change in sequence from CGC to CAC, at the numerical position 17811986 within the gene. Primer Design and Testing The forward and reverse primers found from the DNA near this SNP were GTGCGGGCTCCATCGCAACG and GGAGGAAGGTGTCGCCCCTT respectively. The IN SILICO PCR test, used to insure that the right forward and reverse non-disease primers were formulated, provided a 220 bp sequence, meaning that the primers created from the gene work correctly. (Click on image below to see results of test.)