Wilfred J. Poppinga/Notebook/Wilfreds Project/2009/07/28/ZntR-RBS FW

From OpenWetWare
Jump to navigationJump to search

Sequence ZntR-RBS Forward oligo

5'- AATTCGCGGCCGCTTCTAGAGCGTCCGCTCGCTGTATCTCTGATAAAACTTGACTCTGGAGTCGACTCCAGAGTGTATCCTTCGGTTAATTA - 3'