Wilfred J. Poppinga/Notebook/Wilfreds Project/2009/07/28/CueO-RBS FW

From OpenWetWare
Jump to: navigation, search

Sequence CueO-RBS Forward oligo

5'- AATTCGCGGCCGCTTCTAGAGTTGACCTTCCCGTAAGGGGAAGGACTATGCTCAACGTTTGATTTTA - 3'