Wilfred J. Poppinga/Notebook/Wilfreds Project/2009/07/28/ArsRpromo-RBS REV

From OpenWetWare
Jump to navigationJump to search

Sequence ArsRpromo-RBS Reverse oligo

5'- CTAGTAATTGTTGCAGGTAGTGTCTCTCTTCGAAGCGGATAAGTCAAAAACATATATGACTTAACGAATGTGTAAGTGCAGCTCTAGAAGCGGCCGCG - 3'