Van Oudenaarden Lab:F31A3.2

From OpenWetWare
Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>F31A3.2 (spliced + UTR - 720) ATGCCAAAAG TACATCAAGC AACATTTCCA AAAGCCAGTG TCCATTCAGT TCCATACAAC CAAACTCGAA AATCAGTTTC CGAACGGAAA AGAAGAGATG AAATCAATGA ATTACTGGAA AATCTCAAAA CAATTGTGCA AAATCCTTCT GACAGCAATG AGAAGATTTC ACACGAAACT ATTCTATTCC GTGTGTTTGA ACGGGTTTCT GGAGTTGATT TGGAAACAAA ATTCAACTCA ACCGTTGATA TCCCTAAAGC TGAGGGAAAT ACAAAAGAGG AGAAGCAGAA AGTGAAGACA AAAAGAGAAC AAATCAGAAG AAGTAAGCAA GATATCTGTT ACACCGAACT TGGAAATTTC GTTCACAAAA ACCGACTTGG CAATACTGAG CAAAGGAACA AATTGGAACG CGTAACAGTT TTGCAAATAA TTCTCGAATA CATCTGTCAA ATGCCAGAAC AATCAGAAGC AATAGAAAAG GAAAACTCAC CGATGTACCC AGTGTATCTA GAACCAACTA AATGTATTTC TCCAGAACAA TCCGTCGCTT CTCCCAGCCC GTTCCTTTTT TCAAACACGT TGGCATTCTT CAATCAGGTT GCACAGCTCC ATTTTATCGC GAAACTTCAA GCTATGCTCC CACCGACGCC AGTTCAAACA CCAGAAGCCC ACATGAAAGA GCAAACTAAT GAAGAGGAAG ATATCGATAT TATTGGCTGA


Name of probe set: hlh-28 Probes designed on Wed, 03 Mar 10 23:44:28 -0700 30 probes designed for target of length 720

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

gcttgatgtacttttggcat, hlh-28_1, 1, 1, 40 gacactggcttttggaaatg, hlh-28_2, 2, 23, 45 gtttggttgtatggaactga, hlh-28_3, 3, 46, 40 ccgttcggaaactgattttc, hlh-28_4, 4, 68, 45 cattgatttcatctcttctt, hlh-28_5, 5, 90, 30 gttttgagattttccagtaa, hlh-28_6, 6, 112, 30 ctgtcagaaggattttgcac, hlh-28_7, 7, 136, 45 gtttcgtgtgaaatcttctc, hlh-28_8, 8, 160, 40 cgttcaaacacacggaatag, hlh-28_9, 9, 184, 45 gtttccaaatcaactccaga, hlh-28_10, 10, 208, 40 ggatatcaacggttgagttg, hlh-28_11, 11, 234, 45 cttttgtatttccctcagct, hlh-28_12, 12, 258, 40 gtcttcactttctgcttctc, hlh-28_13, 13, 280, 45 cttcttctgatttgttctct, hlh-28_14, 14, 304, 35 cggtgtaacagatatcttgc, hlh-28_15, 15, 327, 45 gtcggtttttgtgaacgaaa, hlh-28_16, 16, 357, 40 ttcctttgctcagtattgcc, hlh-28_17, 17, 379, 45 caaaactgttacgcgttcca, hlh-28_18, 18, 404, 45 gacagatgtattcgagaatt, hlh-28_19, 19, 429, 35 gcttctgattgttctggcat, hlh-28_20, 20, 451, 45 cggtgagttttccttttcta, hlh-28_21, 21, 473, 40 gttctagatacactgggtac, hlh-28_22, 22, 495, 45 gacggattgttctggagaaa, hlh-28_23, 23, 527, 45 ttgaaaaaaggaacgggctg, hlh-28_24, 24, 555, 45 ctgattgaagaatgccaacg, hlh-28_25, 25, 578, 45 cgataaaatggagctgtgca, hlh-28_26, 26, 600, 45 gggagcatagcttgaagttt, hlh-28_27, 27, 622, 45 tctggtgtttgaactggcgt, hlh-28_28, 28, 646, 50 agtttgctctttcatgtggg, hlh-28_29, 29, 668, 45 tatcgatatcttcctcttca, hlh-28_30, 30, 690, 35


Input sequence with probe locations:


atgccaaaagtacatcaagcaacatttccaaaagccagtgtccattcagttccatacaaccaaactcgaa tacggttttcatgtagttcg gtaaaggttttcggtcacag agtcaaggtatgttggtttg ctt Probe # 1, 40% GC Probe # 2, 45% GC Probe # 3, 40% GC Pro

aatcagtttccgaacggaaaagaagagatgaaatcaatgaattactggaaaatctcaaaacaattgtgca ttagtcaaaggcttgcc ttcttctctactttagttac aatgaccttttagagttttg cacgt be # 4, 45% GC Probe # 5, 30% GC Probe # 6, 30% GC Probe

aaatccttctgacagcaatgagaagatttcacacgaaactattctattccgtgtgtttgaacgggtttct tttaggaagactgtc ctcttctaaagtgtgctttg gataaggcacacaaacttgc aga

# 7, 45% GC       Probe # 8, 40% GC       Probe # 9, 45% GC       Pro

ggagttgatttggaaacaaaattcaactcaaccgttgatatccctaaagctgagggaaatacaaaagagg cctcaactaaacctttg gttgagttggcaactatagg tcgactccctttatgttttc c be # 10, 40% GC Probe # 11, 45% GC Probe # 12, 40% GC P

agaagcagaaagtgaagacaaaaagagaacaaatcagaagaagtaagcaagatatctgttacaccgaact tcttcgtctttcacttctg tctcttgtttagtcttcttc cgttctatagacaatgtggc robe # 13, 45% GC Probe # 14, 35% GC Probe # 15, 45% GC

tggaaatttcgttcacaaaaaccgacttggcaatactgagcaaaggaacaaattggaacgcgtaacagtt

     aaagcaagtgtttttggctg  ccgttatgactcgtttcctt     accttgcgcattgtcaa
     Probe # 16, 40% GC    Probe # 17, 45% GC       Probe # 18, 45% G

ttgcaaataattctcgaatacatctgtcaaatgccagaacaatcagaagcaatagaaaaggaaaactcac aac ttaagagcttatgtagacag tacggtcttgttagtcttcg atcttttccttttgagtg C Probe # 19, 35% GC Probe # 20, 45% GC Probe # 21, 40% GC

cgatgtacccagtgtatctagaaccaactaaatgtatttctccagaacaatccgtcgcttctcccagccc gc catgggtcacatagatcttg aaagaggtcttgttaggcag gtcggg

   Probe # 22, 45% GC              Probe # 23, 45% GC          Probe 

gttccttttttcaaacacgttggcattcttcaatcaggttgcacagctccattttatcgcgaaacttcaa caaggaaaaaagtt gcaaccgtaagaagttagtc acgtgtcgaggtaaaatagc tttgaagtt

  1. 24, 45% GC Probe # 25, 45% GC Probe # 26, 45% GC Probe # 2

gctatgctcccaccgacgccagttcaaacaccagaagcccacatgaaagagcaaactaatgaagaggaag cgatacgaggg tgcggtcaagtttgtggtct gggtgtactttctcgtttga acttctccttc 7, 45% GC Probe # 28, 50% GC Probe # 29, 45% GC Probe # 30,

atatcgatattattggctga tatagctat

35% GC