Van Oudenaarden Lab:C17C3.7

From OpenWetWare
Jump to: navigation, search


Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:



Name of probe set: hlh-25 Probes designed on Wed, 03 Mar 10 22:55:07 -0700 32 probes designed for target of length 807

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

gactgaataacttttggcat, hlh-25_1, 1, 1, 35 ggaacgataatcgctcattg, hlh-25_2, 2, 23, 45 ttggagtttgattgtatggg, hlh-25_3, 3, 45, 40 cttttccgttcagaagctga, hlh-25_4, 4, 67, 45 gcattcgttaatcaactcgt, hlh-25_5, 5, 101, 40 ctgatttttgaacaatcgtc, hlh-25_6, 6, 123, 35 cggaagagaactacttcttg, hlh-25_7, 7, 160, 45 ctccagtcacaagtttcaca, hlh-25_8, 8, 183, 45 gaggtcattcgatgagaaat, hlh-25_9, 9, 218, 40 acttccgtcttgtagattcg, hlh-25_10, 10, 240, 45 cttctttcggattcagtatc, hlh-25_11, 11, 262, 40 ttcacgttcagtcttcactt, hlh-25_12, 12, 284, 40 cttgtttctttcttcgaatc, hlh-25_13, 13, 306, 35 ttcaattcagcataacagtc, hlh-25_14, 14, 328, 35 cttcccatttgtttgttcaa, hlh-25_15, 15, 358, 35 caagttttaatcgttgctcg, hlh-25_16, 16, 381, 40 atttctagaattgtgatccg, hlh-25_17, 17, 403, 35 cagaagatcggaattgtgtt, hlh-25_18, 18, 440, 40 tttggggaattgtttctgga, hlh-25_19, 19, 462, 40 tttccagctaaaagaggaag, hlh-25_20, 20, 484, 40 gttctcacaagtagcagttg, hlh-25_21, 21, 506, 45 ccattcgtgtttttggcttt, hlh-25_22, 22, 537, 40 tcttgggaagagatccttca, hlh-25_23, 23, 560, 45 cttgaacttcttgaaacgtc, hlh-25_24, 24, 582, 40 atggagaagtagatgttggg, hlh-25_25, 25, 606, 45 ggaatacatggaaatgtgag, hlh-25_26, 26, 628, 40 gaactgagtagttgggatca, hlh-25_27, 27, 650, 45 cggtgttgtagtttgacaag, hlh-25_28, 28, 675, 45 ggagcagaaaatattgatgg, hlh-25_29, 29, 697, 40 gtgatggaagaatgaatcgg, hlh-25_30, 30, 720, 45 cgtcactagtttctggtgtt, hlh-25_31, 31, 750, 45 cgagggtttcttcattttct, hlh-25_32, 32, 774, 40

Input sequence with probe locations:

atgccaaaagttattcagtcttcaatgagcgattatcgttccgtcccatacaatcaaactccaaaatcag tacggttttcaataagtcag gttactcgctaatagcaagg gggtatgttagtttgaggtt agtc Probe # 1, 35% GC Probe # 2, 45% GC Probe # 3, 40% GC Prob

cttctgaacggaaaagaagaaatattacaaacgagttgattaacgaatgcaagacgattgttcaaaaatc gaagacttgccttttc tgctcaactaattgcttacg ctgctaacaagtttttag e # 4, 45% GC Probe # 5, 40% GC Probe # 6, 35% GC

agaagaagaacatatatcacaagaagtagttctcttccgaattgtgaaacttgtgactggagttaatctg tc gttcttcatcaagagaaggc acactttgaacactgacctc

                  Probe # 7, 45% GC      Probe # 8, 45% GC           


      taaagagtagcttactggag  gcttagatgttctgccttca  ctatgacttaggctttctt
      Probe # 9, 40% GC     Probe # 10, 45% GC    Probe # 11, 40% GC 

gaaaagtgaagactgaacgtgaaaagattcgaagaaagaaacaagatgactgttatgctgaattgaaatt c ttcacttctgacttgcactt ctaagcttctttctttgttc ctgacaatacgacttaactt

  Probe # 12, 40% GC    Probe # 13, 35% GC    Probe # 14, 35% GC     


      aacttgtttgtttacccttc   gctcgttgctaattttgaac  gcctagtgttaagatctt
      Probe # 15, 35% GC     Probe # 16, 40% GC    Probe # 17, 35% GC

atcatcattgattacattaaacacaattccgatcttctgtatccagaaacaattccccaaatacttcctc ta ttgtgttaaggctagaagac aggtctttgttaaggggttt gaaggag

                  Probe # 18, 40% GC    Probe # 19, 40% GC    Probe #

ttttagctggaaaatcaactgctacttgtgagaacaaagagaatgaaaagccaaaaacacgaatggaagt aaaatcgaccttt gttgacgatgaacactcttg tttcggtttttgtgcttacc a

20, 40% GC    Probe # 21, 45% GC             Probe # 22, 40% GC     P

gaaggatctcttcccaagattgacgtttcaagaagttcaagaatccccaacatctacttctccattgctc cttcctagagaagggttct ctgcaaagttcttcaagttc gggttgtagatgaagaggta gag robe # 23, 45% GC Probe # 24, 40% GC Probe # 25, 45% GC Pro

acatttccatgtattccaatgatcccaactactcagttcaatgtcttgtcaaactacaacaccgttccat tgtaaaggtacataagg actagggttgatgagtcaag gaacagtttgatgttgtggc ggta be # 26, 40% GC Probe # 27, 45% GC Probe # 28, 45% GC Prob

caatattttctgctcccctccgattcattcttccatcacttcaaatcttaacaccagaaactagtgacga gttataaaagacgagg ggctaagtaagaaggtagtg ttgtggtctttgatcactgc e # 29, 40% GC Probe # 30, 45% GC Probe # 31, 45% GC


  Probe # 32, 40% GC