Van Oudenaarden Lab:C02F12.5

From OpenWetWare
Jump to: navigation, search

Progress:

Probes designed: (03-16-2010 - Apratim Sahay)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>C02F12.5 (spliced + UTR - 652) atataatgaaagttggtacgacagtgccgggcagattcatcaatcgatcagtaaatgttgttcttcactttgctgattcaattatttttggttcccgttttatgccagtacgcttgcagttctgagttgaaatt tggaactgcgtgctctgaaaacaaaacttctacaaagtggtattatgattccaaattattgttttgctatccgtacaagt atttgggatgtggagaaggatcaaactcatttgaatccaacgagaactgccttgaatcttgtaaaccagctgaccaattt tcatgcggcggcaatactggccctgatggtgtctgcttcgctcacggagatcaaggatgcaaaaaaggaacggtgtgtgt gatgggaggaatggttggattctgctgtgataagaaaattcaagacgaatggaacaaggagaattcaccaaagtgtttga aaggtcaagttgtccaattcaagcaatggtttggaatgacgcctcttattggacgtagttgttcgcataatttctgtccc gagaaatcgacatgcgtacagggaaaatggactgcttattgttgccaataattcatctttctgtaaccctgttcttgtaatgtatatttgcgatcgaatgaatttctctgaa aaagta


Name of probe set: C02F12.5 Probes designed on Wed, 17 Mar 10 16:51:38 -0700 25 probes designed for target of length 652

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC


cactgtcgtaccaactttca, C02F12.5_1, 1, 7, 45 atcgattgatgaatctgccc, C02F12.5_2, 2, 29, 45 cagcaaagtgaagaacaaca, C02F12.5_3, 3, 56, 40 ggcataaaacgggaaccaaa, C02F12.5_4, 4, 87, 45 aactcagaactgcaagcgta, C02F12.5_5, 5, 109, 45 agagcacgcagttccaaatt, C02F12.5_6, 6, 131, 45 ccactttgtagaagttttgt, C02F12.5_7, 7, 155, 35 cttgtacggatagcaaaaca, C02F12.5_8, 8, 194, 40 atccttctccacatcccaaa, C02F12.5_9, 9, 216, 45 ctcgttggattcaaatgagt, C02F12.5_10, 10, 239, 40 gtttacaagattcaaggcag, C02F12.5_11, 11, 261, 40 ccgcatgaaaattggtcagc, C02F12.5_12, 12, 283, 50 acaccatcagggccagtatt, C02F12.5_13, 13, 307, 50 tgcatccttgatctccgtga, C02F12.5_14, 14, 336, 50 atcacacacaccgttccttt, C02F12.5_15, 15, 358, 45 agcagaatccaaccattcct, C02F12.5_16, 16, 381, 45 ccttgttccattcgtcttga, C02F12.5_17, 17, 414, 45 cctttcaaacactttggtga, C02F12.5_18, 18, 439, 40 cattgcttgaattggacaac, C02F12.5_19, 19, 463, 40 caataagaggcgtcattcca, C02F12.5_20, 20, 486, 45 ggacagaaattatgcgaaca, C02F12.5_21, 21, 514, 40 ctgtacgcatgtcgatttct, C02F12.5_22, 22, 536, 45 ggcaacaataagcagtccat, C02F12.5_23, 23, 561, 45 cagggttacagaaagatgaa, C02F12.5_24, 24, 586, 40 gagaaattcattcgatcgca, C02F12.5_25, 25, 623, 40


Input sequence with probe locations:


atataatgaaagttggtacgacagtgccgggcagattcatcaatcgatcagtaaatgttgttcttcactt

     actttcaaccatgctgtcac  cccgtctaagtagttagcta       acaacaagaagtgaa
     Probe # 1, 45% GC     Probe # 2, 45% GC          Probe # 3, 40% 

tgctgattcaattatttttggttcccgttttatgccagtacgcttgcagttctgagttgaaatttggaac acgac aaaccaagggcaaaatacgg atgcgaacgtcaagactcaa ttaaaccttg GC Probe # 4, 45% GC Probe # 5, 45% GC Probe # 6,

tgcgtgctctgaaaacaaaacttctacaaagtggtattatgattccaaattattgttttgctatccgtac acgcacgaga tgttttgaagatgtttcacc acaaaacgataggcatg

45% GC       Probe # 7, 35% GC                      Probe # 8, 40% GC

aagtatttgggatgtggagaaggatcaaactcatttgaatccaacgagaactgccttgaatcttgtaaac ttc aaaccctacacctcttccta tgagtaaacttaggttgctc gacggaacttagaacatttg

    Probe # 9, 45% GC      Probe # 10, 40% GC    Probe # 11, 40% GC  

cagctgaccaattttcatgcggcggcaatactggccctgatggtgtctgcttcgctcacggagatcaagg

 cgactggttaaaagtacgcc    ttatgaccgggactaccaca         agtgcctctagttcc
 Probe # 12, 50% GC      Probe # 13, 50% GC           Probe # 14, 50%

atgcaaaaaaggaacggtgtgtgtgatgggaggaatggttggattctgctgtgataagaaaattcaagac tacgt tttccttgccacacacacta tccttaccaacctaagacga agttctg

GC    Probe # 15, 45% GC     Probe # 16, 45% GC               Probe #

gaatggaacaaggagaattcaccaaagtgtttgaaaggtcaagttgtccaattcaagcaatggtttggaa cttaccttgttcc agtggtttcacaaactttcc caacaggttaagttcgttac acctt

17, 45% GC       Probe # 18, 40% GC      Probe # 19, 40% GC     Probe

tgacgcctcttattggacgtagttgttcgcataatttctgtcccgagaaatcgacatgcgtacagggaaa actgcggagaataac acaagcgtattaaagacagg tctttagctgtacgcatgtc

# 20, 45% GC          Probe # 21, 40% GC    Probe # 22, 45% GC       

atggactgcttattgttgccaataattcatctttctgtaaccctgttcttgtaatgtatatttgcgatcg tacctgacgaataacaacgg aagtagaaagacattgggac acgctagc Probe # 23, 45% GC Probe # 24, 40% GC Probe #

aatgaatttctctgaaaaagta ttacttaaagag 25, 40% GC