User:Student 59/Notebook/Biology 210 at AU

From OpenWetWare
Jump to navigationJump to search

Caroline Sell

Bio 210 - 007


Lab...

Preparation for rat dissection


Lab 6-7-8: 02-18-16 - 03-03-16, Embryology and Development--Zebrafish Experiment

Purpose

The purpose of today's lab is to shift away from looking at our transect ecosystem and start examining the different stages of life. We learned about embryology and the different stages of development. To do this, we started our Zebrafish experiment. Based on the article we read entitled "Effect of salinity on development of zebrafish"

Materials and Methods


Data and Observations


Daily log:

  • Day 0 (02-18-16): We began our experiment
  • Day 1 (02-19-16): We came in to see if anything had hatched yet. None yet.
  • Day 4 (02-22-16): We observed that by day 4 most of the controls had hatched. Three did not hatch (A1, D1, D4). The picture below is of D6. We changed the water of the control fish. We took out whatever water was picked up with the casings and then added 0.5mL of clean control water. We then added 15 micro-litters of brine shrimp solution to each control fish well.

We changed the water of the experimental fish. We took out 1.1mL of the water from the NaCl concentration and put in 1mL more of clean 6% NACL Concentration. None of the fish hatched. Ones that look dead Plate 1: C2. Plate 2: A3. These look dead because the casing was empty and there are no fish in the well. Accidentally took out Plate 2: A4, when changing the water.

--> eyes (only controls, nothing hatched for NaCl)  9 occular spaces
--> color (controls): yellowish green
  • Day 5 (02-23-16): Came to see what fish looked like and to feed the controls. The Experimental fish: Dead: Plate 1: C2. Plate 2: A3, C3. Plate 2: A4 is not a thing anymore. None have hatched.

The Control Fish: No more controls hatched. We feed the controls that had previously hatched more food.

  • Day 6 (02-24-16): The Control Fish: No more controls hatched. We feed the controls that had previously hatched more food. The Experimental fish: Dead: Plate 1: C2. Plate 2: A3, C3. Plate 2: A4 is not a thing anymore. None have hatched. They look the same.
  • Day 7 (02-25-16): So we discovered that we put too much salt in the concentration. We went through both plates of our experimental fish eggs and chose a selection (4) of the ones that looked like they were a little bit farther along in egg development to fix in paraformaldehyde.

We have to change our experiment a bit. We are splitting half of the controls and using them as our experiment. That means we will be treating the new experimental fish with 0.5% NaCl solution as provided in lab. Then we will observe the fish living in the control water and the fish living in the NaCl.

--> color (all controls since we put too much NaCl in the experiment): yellowish brown

NaCl at 6% Plate 1: C2 is dead, Plate 2: A3, C2, C3 dead 4 fish eggs that were probably dead but not disintegrated were preserved.

New experiment! 0.5% 11 new ones, and 10 controls. We feed them all, and changed the water of the controls.

  • Day 8 (02-26-16): This was our first day with the new experiment. All the fish (both experiments) were alive. They were fed and observed.
--> eyes (10 occular spaces)
--> color: no difference yet since they were split yesterday
  • Day 11 (02-29-16, FOUR DAYS AFTER BEING SPLIT): Fed and observed. Water was changed. 1ml was taken out and 1ml of Control water (for controls) or 5mg/L NaCl solvent water solution (for experiment) was added.
--> eyes (control: 11 occular spaces, round shaped      salinity: 13 occular spaces, oval shaped )  
--> color (control: yellowish brown, spotted body       salinity: light yellow, MUCH more translucent than control, spotted body, yolk sac prominent)
  • Day 12 (03-01-16): It is know that some just zebrafish just up and die around the two week mark. Each one that is alive has been fed.

NaCl A1 is almost dead. A4 is definitely dead.

NaCl lethargic swimming, maybe almost dead: C4

NaCl Swimming funny: A2, C3, B3

NaCl upside down/vertical: A3, B2, C2

NaCl appears normal: B1, B4

Control: B3, B4, B5 are dead. A3 and B2 are almost dead.

Control: insects or something have grew in A5 with the fish. All controls have these gnat like things. A2 is the only one that does not have these

--> eyes (control: 13 occular spaces, round shaped      salinity: 14 occular spaces, oval shaped )
--> color (control: much darker yellow/brown/grey, dark spots, can hardly see yolk sac                 salinity: light yellow, body lightly spotted, still translucent, and yolk sac very prominent )
  • Day 13 (03-02-16): All of controls died, salinity died A1 and B2, A1 NaCl disintegrating
--> color (control: died           salinity: very light yellow color, almost white/transparent, very prominent yolk sac, overall much thinner body)

ALL CONTROLS DIED. they were fixed. A1 and B2 of experimental zebrafish died. they were fixated. The rest were fed.

  • Day 14 (03-03-16):
--> eyes on salinity NaCl experiment (because all controls died, can only observe experiment) : 15 ocular spaces on 4x

One of the water mixes used to replace water in control may have been contaminated, which is why we saw ticks living with our fish. Salinity was a different solution or it could have killed the ticks because of the NaCl. This might be why our controls died.


Conclusions and Future Directions


CLS



Lab 7: 02-25-16, 16S Sequence Analysis of Bacteria Cultures

Purpose

The purpose of this experiment was to identify bacteria species within our transect as a part of our previous lab on bacteria. This data is a continuation of the Hay Infusion culture earlier this semester. With the agar plates we made from the serial dilutions of the Hay Infusion, we performed a Polymerase Chain Reaction (PCR) sequencing to amplify the bacterial genomic DNA and then gel electrophoresis to test the 16S gene and ultimately determine what kind of bacteria we were looking at.


Materials and Methods

  • Latex gloves
  • Agarose gel
  • Gel box and lid
  • Stainless steel wire
  • 9V batteries
  • UV box light

To do this, we added 20μL of primer/water mixture to the labeled PCR tube and then shook the tube to dissolve the PCR bead. Then we took a small sample from the agar plate with a toothpick and mixed it around in the tube. The next week we ran them through the agarose gel to determine the PCR results.


Data and Observations

When our group did this experiment, our PCR results did not work. So, we have collected the following sequence from another group that had the same transect (#2) as we did.

Error creating thumbnail: File missing
Agarose Gel from 16S Sequence Analysis results using PCR of Bacteria Cultures from Transect

MB43 (16s Sequence from Agar plate with Nutrient 10^-5): GGNNNNNNNNNNNNNNNNANNNTGCAGTCGTACAGGTAGCCGTAANTTGCTCTCGGGTGACGAGTGGCGGACGGGTGANT MB43 GGNNNNNNNNNNNNNNNNANNNTGCAGTCGTACAGGTAGCCGTAANTTGCTCTCGGGTGACGAGTGGCGGACGGGTGANTAATGT CTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTT CGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTC TGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCG CAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTGTGGTTAAT AACCGCAGCAATTGACGTTACCCGCANAANAAGCACCGGCTAACTCCGTGCCAGCANCCGCGGTAATACGGANGGTGCAAGCGTTA ATCGGNAATTACTGGGCGTAAAAGCGCACGCAGGCGGTCTGTCAA GTCGGATGTGAAANTCCCCCGGGCTCAACCTGGGAACTG


Conclusions and Future Directions

Using the blast website, we found that the bacteria from this samples was Variovorax Sp. ML3-12 16S ribosomal RNA gene, partial sequence. The Variovorax was described on the http://blast.ncbi.nlm.nih.gov as part of a study in which soil sample was isolated from a greenhouse. It was described as a gram-positive, non-spore forming, and a rod shaped bacterium with irregular light colonies.

We found that these results were consistent with the characteristics of the bacteria found in our transect, and this showed that PCR 16S Sequencing was another successful way to characterize and identify elements present in the transect.


CLS



Lab 5: 02-11-16, Invertebrates and Vertebrates

Purpose

The purpose of this lab was to examine another category of life found in our transects: invertebrates. Just like our plant lab last week, if we are able to better understand what is living in our transect, we can get a better picture of the ecosystem of the transect as a whole. Last week we prepared a Berlese Funnel to collect invertebrates. Another group actually dismounted our tube of 50:50 ethanol/water solution, so they had taken some of our sample. Also during this lab we were able to observe various Acoelomates, Pseudocoelomates, and Coelomates with the dissecting scope and various arthropods that were in large glass jars. However, most of today's lab was focused on identifying the invertebrates from our transect.


Materials and Methods

  • Berlese Funnel (prepared last week)
  • petri dishes
  • transfer pipettes
  • dissecting microscope
  • phone camera
  • computer for identification (hope.edu website)


Data and Observations

Since we were using a dissecting microscope, it was a bit harder at first to see clearly our specimens. Once we figured out how to properly use the microscope, we took our tube and poured the liquid out into a few petri dishes. We looked around for specimens floating and once we located one, transferred it to another petri dish so we could focus on it. Each time we found a different specimen and these are listed below in the images.

Error creating thumbnail: File missing
image of grasshopper through microscope
Error creating thumbnail: File missing
dichotomous key for grasshopper


Error creating thumbnail: File missing
image of plant lice through microscope
Error creating thumbnail: File missing
dichotomous key for plant lice

Image 3 - fly

Error creating thumbnail: File missing
dichotomous key for fly


Error creating thumbnail: File missing
image of springtail through microscope
Error creating thumbnail: File missing
dichotomous key for springtail
Error creating thumbnail: File missing
image of cicada through microscope
Error creating thumbnail: File missing
dichotomous key for cicada

The following table shows the details of each specimen found in our transect:

Specimens found in Transect 2


In addition to the invertebrates we found with the help of our Berlese Funnel, we also observed the following vertebrates in our transect.

1. Squirrel (sciurus carolinensis): classification, biotic - trees, abiotic - soil (for digging for seeds)

2. Mouse (Mus musculus): classification, biotic - green plants, abiotic - water

3. Raccoon (Chaetodon): classification, biotic - small rodents, abiotic - trash

4. Sparrow (Aimophila notosticta): classification, biotic - insects, abiotic - mud for nest

5. Robin (Cinclidium diana): classification, biotic - worms (earthworm), abiotic - sticks/branches


Error creating thumbnail: File missing
Basic food web


Conclusions and Future Directions

From this lab, we were able to better see the insects and invertebrates currently living in our transect. It was interesting to see that there were so many organisms still alive throughout these winter months. Using the dichotomous key on the hope.edu website, we were able to identify each organism. We were also able to think of our transect with a greater lens, incorporating other animals that we observe or expect to see in our transect. With all the labs these past few weeks, we have been able to characterize each level of life in our transect.


CLS



Lab 4: 02-04-16, Plantae and Fungi

Purpose

The purpose of today's lab was to examine plants and fungi, especially plants found in our transect, to understand their diversity of appearance and function. By dissecting plants, we can see the intricate differences that make each plant important for the ecosystem they are living in.

Materials and Methods

  • 3 Ziploc bags
  • phone camera
  • 50:50 ethanol/water solution
  • conical tube
  • screening material
  • scissors
  • tape
  • funnel
  • ring stand
  • 40 watt lamp
  • foil

Like last week, this lab consisted of multiple procedures and they will be described below with their corresponding data and observations.

Data and Observations

Procedure 1: Collect 5 plant samples from transect

We took 3 ziploc bags and our phone cameras back out to our transect #2 to collect samples. We found an area with soft soil (everything was pretty soft since it had just rained/snowed) and picked up dead leaves for our leaf liter sample. We collected about 25-30 leaves (~500g). We also searched for representative samples from five plants and collected a seed, a flower bud, a bushel of flower petals, a long leaf, and a short leaf. The images of the organisms are below along with a map of where they were found:

Error creating thumbnail: File missing
Map of locations of organisms in transect #2
Error creating thumbnail: File missing
Seed, #1 on map
Error creating thumbnail: File missing
flower buds (bottom ones are dissected), #2 on map
Error creating thumbnail: File missing
bushel of flower petals, #3 on map
Error creating thumbnail: File missing
individual flower petal, #3 on map
Error creating thumbnail: File missing
long leaf, #4 on map
Error creating thumbnail: File missing
short leaf, #5 on map


Procedure 2: Plant Vascularization

Of the specimens we collected, we took a closer look at the vascularization of each one and recorded it in the table in procedure 4

Procedure 3: Presence of Specialized Structures

The leaf litter we collected consisted mostly of large maple-type leaves. They covered the entire soil in our transect, as the trees were leafless since it is winter. Also since it had rained/snowed recently, they were very wet/damp.

Error creating thumbnail: File missing
leaf litter example

Procedure 4: Mechanisms of Plant Reproduction

To take a closer look at the seeds we brought back from our transect, we dissected them to find out if they were monocot or dicot. A table of results is below.

Error creating thumbnail: File missing
Table of results from observing plant samples

Procedure 5: Observing Fungi

The fungi that we observed was a fungi called Rhizopus Stolnifer. They are a part of the Ascomycota group since it is bread/yeast. Below are images of what we observed.

Error creating thumbnail: File missing
Image of fungi name
Error creating thumbnail: File missing
Image of fungi through microscope
Error creating thumbnail: File missing
Image of fungi description


Procedure 6: Setting Up the Berlese Funnel to Collect Invertebrates

To set up the Berlese Funnel for next week's lab, we took a 50 ml conical tube and poured 25 ml of the 50:50 ethanol/water solution. We cut out a piece of screening material and put it in the bottom of the funnel and taped the sides so it did not move. Then we put the leaf litter on top of the funnel and set it all on a ring stand. We taped the funnel and tube together and placed it under a 40 watt lamp to be observed next week.

Error creating thumbnail: File missing
Image of Berlese Funnel


Conclusions and Further Directions

From this lab, we were able to see first hand the variety of plants in just our small transect. Some were monocot, others were dicot. We learned how to identify plant vascularization. By having all these tools, we can create a more complete picture of our transect and next lab, we will be using our Berlese Funnel to add invertebrates to our list of organisms found in our small area of AU's campus.


CLS



Lab 3: 01-28-16, Microbiology and Identifying Bacteria

Purpose

The purpose of today's lab was to take a closer look at the bacteria present in our culture, now that we understand more about the specific microorganisms from last lab. There is great diversity in bacteria, and bacteria are everywhere in the world. We will be able to categorize the types of bacteria based on shape, motility, gram stain, and antibiotic resistance.


Materials and Methods

  • Hay Infusion Culture (*prepared previous week)
  • Latex Gloves
  • Microscope
  • (8) Slides and slide covers
  • Transfer pipettes
  • Dichotomous Key (*aid in identifying microorganisms)
  • Crystal Violet
  • Distilled water
  • Alcohol Decolorizer
  • Iodine
  • Safranin

There were multiple parts to this lab. But before we describe the processes, it is first important to note that before we did anything, we observed our Hay Infusion Culture one last time. As of today, it has been sitting for 2 weeks. There were no changes in smell but the appearance did change. All the organisms we saw growing at each layer were nearly gone. There was a lot of dirt that had sunk to the bottom, and the top layer was extremely reduced. We observed that 50% of the water had evaporated. We hypothesize that there was a change in appearance because there were no more nutrients left in the culture and everything died. However, we did see that there was growth on our agar plates because there were nutrients present allowing bacteria to cultivate.

Error creating thumbnail: File missing
Image of Hay Infusion culture after 2 weeks, part 1
Error creating thumbnail: File missing
Image of Hay Infusion culture after 2 weeks, part 2

There were 5 procedures to complete for this lab. The descriptions are below with their corresponding data and observations.


Data and Observations

Procedure 1: Quantifying and Observing Microorganisms

We used colony morphology to help determine the type of bacteria growing on our plates. We counted the colonies on each plate, and made sure we divided by 100 to keep the units the same (colonies/um) since we made the cultures with 100 μL.

Error creating thumbnail: File missing
Table1: 100-fold serial dilutions results

According to this table, there were no results for the 10^-5 tet, 10^-7 with and without tet, and 10^9 with and without tet plates.


Procedure 2: Antibiotic Resistance

Based on the table above and the images of the plates below, we saw that for the previously mentioned plates, there was no growth at all. The only plates we could compare tet/no tet were the 10^-3 plates and we saw that the growth looked slightly different. The colonies on the plate with tet were larger, more spread out, and brighter in color whereas the colonies on the plate without tet were smaller and covered more of the plate. Neither of these was quite enough to be a lawn. The differences in colony type could indicate that the antibiotic did not allow for as many smaller colonies to grow as we saw with the plate without tet. As seen in the table above, there were significantly fewer colonies on the plate with tet than on the plate without tet. There appeared to be presence of some fungi on each of the plates where there was growth.

Error creating thumbnail: File missing
Top: 10^-3 without, Bottom: 10^-3 with tet
Error creating thumbnail: File missing
Top: 10^-5 without, Bottomr: 10^-5 with tet (condensation present)
Error creating thumbnail: File missing
Top: 10^-7 without (condensation present), Bottom: 10^-7 with tet
Error creating thumbnail: File missing
Top: 10^-9 without (condensation present), Bottom: 10^-9 with tet

Tetracycline is a broad-spectrum antibiotic that inhibits the protein synthesis in bacteria, which prevents it from growing. It can be used on both gram positive and gram negative bacteria such as chlamydiae, mycoplasmas, rickettsiae, and protozoan parasites. However, there has been resistance to tetracycline since 1953 with the Shigella dysenteriae bacterium and now there are 29 different genes in bacteria that have tetracycline resistance as well as three oxytetracycline resistance genes. While tetracycline is is a good antibiotic used for many infections (Streptococcus pneumoniae, typhoid, urinary tract infections, etc.) when there is antibiotic resistance, it makes it much harder to handle the infection.

(Chopra, 2001)


Procedure 3, part 1: Bacteria Cell Morphology Observations

To observe the bacteria from our sample plates, we used a toothpick to pick up a colony of bacteria from 4 plates (10^-3 with tet, 10^-3 without, 10^-5 with tet, 10^-5 without tet) and put them on slides with a drop of water. We placed a cover slip on top and used a compound microscope to take a closer look at the shape and mobility of the bacteria. Below are the images we collected, all at 40x magnification:

Error creating thumbnail: File missing
plate 10^-3 without, shape: coccus (sphere), motility: individual cells moving individually diagonally from top right to bottom left
Error creating thumbnail: File missing
plate 10^-3 with tet, shape: bacillus (rod), motility: individual cells moving back and forth, not changing their original location much, just shifting back and forth, up and down
Error creating thumbnail: File missing
plate 10^-5 without, shape: bacillus (rod), motility: individual cells moving back and forth, not changing their original location much, just shifting back and forth, up and down
Error creating thumbnail: File missing
plate 10^-5 with tet, no bacteria present


Procedure 3, part 2: Gram Stain

To perform the gram stain, we had to first make a wet mount by sterilizing an inoculation loop over a flame and let it cool before picking up a small amount of the sample from our plates. We mixed this with a drop of water on a slide and heat fixed the air dried slide by passing it over the flame. Then we started dying the slide, first using crystal violet (1 min), rinsing, then iodine (1 min), rinsing, then decolorizing with 95% alcohol (10-20 sec), rinsing, and finally with safranin stain (20-30 sec), and rinsing. Any excess water was blotted with a kimwipe and when we went to look at the slide under the microscope, no cover slip was used. Below is a table of the results we found for our slides:

Error creating thumbnail: File missing
TABLE of gram stain
Error creating thumbnail: File missing
Gram Stain (top 10^-3 without, bottom 10^-3 with TET)
Error creating thumbnail: File missing
Gram Stain (top 10^-5 without, bottom 10^5 with TET)
Error creating thumbnail: File missing
view through microscope, 10^-3 without
Error creating thumbnail: File missing
view through microscope, 10^-3 with TET
Error creating thumbnail: File missing
view through microscope, 10^-5 without


Procedure 4: PCR setup for 16S Amplification

We selected to compare the 10^-3 without and 10^-3 with TET samples for our PCR test. To prepare for the test, we labeled 2 PCR tubes with our transect (group) number and colony identifier (10^-3 with and without). We added 25 μL of primer/water mixture to a labeled PCR tube and flicked/mixed the tube to dissolve the PCR bead at the bottom. Then, with a sterile toothpick, we touched a bit of a bacterial colony from each respective plate we were observing and mixed it in with the primer/water mixture of the PCR tube. Then we capped the tube and placed it in the PCR machine to be used for next lab.

Conclusions and Future Directions

We saw that the higher the dilution, the less likely we were to see bacteria, especially when there was tetracycline. This means that a lot of the bacteria was not resistant to the antibiotic. Perhaps we diluted too much which is why nothing showed up in many of the plates. However, we were still able to learn a lot about the bacteria present in our samples from our transect. They were different shapes, sizes, and had different patterns of motility. There is always a reason that organisms look and move differently based upon their function, and we saw this in our lab today.


Works Cited:

Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, 65(2), 232–260. http://doi.org/10.1128/MMBR.65.2.232-260.2001


CLS

What a great entry! So in-depth, well-written and I like how you broke everything off into segments. -Pragati


Lab 2: 01-21-16, Identifying Algae and Protists

Purpose

The purpose of this week's activity was to identify the microorganisms present in our given transects. We learned how to use a dichotomous key to identify microorganisms from different layers of last week's Hay Infusion Culture: top, middle, and bottom layers. It is important to know what exactly is present in the transect to better understand how everything in the area lives together. Below are images of the Hay Infusion Culture after one week of sitting out on the lab bench.

Error creating thumbnail: File missing
Image of Hay Infusion Culture after 1 week, notice the different layers
Error creating thumbnail: File missing
Image of top of Hay Infusion Culture after 1 week


Materials and Methods

  • Hay Infusion Culture (*prepared previous week)
  • Latex Gloves
  • Microscope
  • (6) Slides and slide covers
  • Transfer pipettes
  • Dichotomous Key (*aid in identifying microorganisms)

We made wet mounts for microscopic observation of the culture with samples coming from each of the three layers (top, middle, and bottom). Once we looked at them with the microscope, we took pictures of the microorganisms and attempted to identify what they were by using dichotomous keys for Free-Living Protozoa and Algae.


Data and Observations

When we observed the Hay Infusion Culture, we did not notice any particular smell. There was also a bit of mold on the top of the culture. We noticed some plant matter (algae) near the top of the culture and this would be because of the need to perform photosynthesis and there is more light on top. Along with the algae at the top level we also was Paramecium, which would need the nutrients to survive.

Below are the images of the organisms found at each level (top, middle, and bottom) along with their size and name.

Error creating thumbnail: File missing
Image of Diatom, top level, brownish color, 100 μL
Error creating thumbnail: File missing
Image of Paramecium, Top level, colorless and motile, 10 μL
Error creating thumbnail: File missing
Image of Diatom, middle level, brownish with patterned grooves and rows, 36 μL
Error creating thumbnail: File missing
Image of Diatom, bottom level, brown in color, 150 μL
Error creating thumbnail: File missing
Image of Hydrodictyon, bottom level, grass green color, non motile algae, rod shaped cells joined in a net-like conformation, 42.5 μL



Paramecium: As per the Freeman text, paramecium are protists that are motile. They are a single cell, part of the Alveota lineage, and have 1 macro and 1 micro nuclei. They can reproduce asexually by binary fission or sexually with conjugation. In order for them to survive, they must consume the nutrients surrounding them in their environment, which is why we found them with the diatoms at the top of our culture.


Conclusions and Future Directions

It was interesting that we found diatoms on each level, but this is probably because we took a sample of the water from the creek which would contain this type of algae. We found the most microorganisms at the top of the culture, probably because there is more access to light for the algae to perform photosynthesis and continue to grow. If the Hay Infusion "grew" for another two months, we would expect more growth of algae such as diatoms. We already saw these on each level of our culture. However, there was only 0.1 grams of dried milk and at some point the nutrients would run out and nothing else would be able to grow in the culture (carrying capacity). In terms of learning how to use the dichotomous keys, it was not as easy as it sounds because you have to be very specific when describing the microorganisms or you could end up with the wrong name.



For next lab:

We also prepared and plated serial dilutions using our Hay Infusion Culture. This will be used to take a closer look at the specific bacteria in our culture.

Error creating thumbnail: File missing
Image of process used to prepare agar plates through serial dilutions


CLS



Lab 1: 01-14-16, Examining Biological Life at AU

Purpose

The purpose of this lab was to take a closer look at the biological life around us here at AU. While we study biology, it is important to understand the biological life we interact with each day. This semester, each group will examine a select 20x20 transect located on campus. We had transect #2 which is located by the Amphitheater and Hughes/McDowell Hall. There is a creek, many rocks, bushes, and trees. Below are images and a diagram of the transect. For this week's activity, we collected samples of all elements found in the transect to make a Hay Infusion Culture in lab. We also took notes to describe the biotic and abiotic components of the transect.


Materials and Methods

  • 1 Gallon Ziplock Bag
  • Latex Gloves
  • Flashlight (*transect observed after dark)
  • Camera/camera phone
  • Glass Jar (w/ 1L capacity) with lid
  • 500ml of purified water
  • 0.1 gram of dried milk (*sustenance for living organisms in hay infusion culture)
  • Sharpie
  • Painter's tape or labels

We observed our transect by collecting many elements from the transect and putting them all in a gallon size ziplock bag. Then we took 10-12 grams of the material (soil, leaves, water from the creek, etc.) from the bag and placed it in a glass jar with 500 ml of purified Deer Park water and 0.1 grams of dried milk. We covered the jar to shake it, and then left the lid off for a week so we could come back the week later and observe the organisms.


Data and Observations


Error creating thumbnail: File missing
Image of Hay Infusion Sample
Error creating thumbnail: File missing
Image of Map of Transect
Error creating thumbnail: File missing
Image of Transect part 1
Error creating thumbnail: File missing
Image of Transect part 2
Error creating thumbnail: File missing
Image of Transect part 3


Biotic: bush, trees, moss in water

Abiotic: rocks, sticks, dead leaves


Conclusions and Future Directions

By doing this lab activity we found that our Transect #2 had a lot of water, soil, and dead leaves since there was a creek that ran right through it and the leaves had fallen since it is winter. When we look for organisms in our Hay Infusion Sample next week, I expect to see a good variety of microorganisms that live in the water since our location must rely on the water to produce life in the area.


CLS

.