Zebra Fish Experiment - Salinity, LAB 6/7/9 FEB 18-March 3, 2016
Material: 6% NACL Water Soultion
Method: Leave the Experimental zebrafish eyes in the solution until hatching.
Hypothesis: That leaving zebrafish embryos in 6% NACL Water concentration will increase hatching time (takes longer).
Source: Sawant, M. S., Zhang, S., & Li, L. (2001). Effect of salinity on development of zebrafish, Brachydanio rerio. Current Science, 81(10), 1347-1350. Retrieved from http://www.iisc.ernet.in/currsci/nov252001/1347.pdf
Friday 2/19: Came to see what the fish looked like. All the fish did not hatch.
Monday 2/22, DAY 4: Came in to see what the fish looked like. Almost all of the controls hatched. Three did not hatch (A1, D1, D4). The picture below is of D6.
We changed the water of the control fish. We took out what ever water was picked up with the casings and then added 0.5mL of clean control water. We then added 15 micro-litters of brine shrimp solution to each control fish well.
We changed the water of the experimental fish. We took out 1.1mL of the water from the NACL concentration and put in 1mL more of clean 6% NACL Concentration. None of the fish hatched. Ones that look dead Plate 1: C2. Plate 2: A3. These look dead because the casing was empty and there are no fish smiling in the well. Accidentally took out Plate 2: A4, when changing the water.
Tuesday 2/23: Came to see what fish looked like and to feed the controls.
The Experimental fish: Dead: Plate 1: C2. Plate 2: A3, C3. Plate 2: A4 is not a thing anymore. None have hatched.
The Control Fish"No more controls hatched. We feed the controls that had previously hatched more food.
Wednesday, 2/24:
The Control Fish"No more controls hatched. We feed the controls that had previously hatched more food.
The Experimental fish: Dead: Plate 1: C2. Plate 2: A3, C3. Plate 2: A4 is not a thing anymore. None have hatched. They look the same.
Thursday, 2/25, DAY 7:
So we discovered that we put too much salt in the concentration.
We went through both plates of our experimental fish eggs and chose a selection (4) of the ones that looked like they were a little bit farther along in egg development to fix in paraformaldehyde.
We have to change our experiment a bit. We are splitting half of the controls and using them as our experiment. That means we will be treating the new experimental fish with 0.5% NaCl solution as provided in lab. Then we will observe the fish living in the control water and the fish living in the NaCl.
NaCl at 6%
Plate 1: C2 is dead,
Plate 2: A3, C2, C3 dead
4 fish eggs that were probably dead but not disintegrated were preserved.
New experiment!
0.5% 11 new ones, and
10 controls.
We feed them all, and changed the water of the controls.
Friday, 2/26, DAY 8
This was our first day with the new experiment. All the fish (both experiments) were alive. They were fed and observed.
Monday, 2/29, DAY 11
Feed and observed. Water was changed. 1ml was taken out and 1ml of Control water (for controls) or 5mg/L NaCl solvent water solution (for experiment) was added.
Tuesday, 3/1, DAY 12
It is know that some just zebrafish just up and die around the two week mark. Everyone that is alive has been fed.
NaCl A1 is almost dead. A4 is definitely dead.
NaCl lethargic swimming, maybe almost dead: C4
NaCl Swimming funny: A2, C3, B3
NaCl upside down/vertical: A3, B2, C2
NaCl appears normal: B1, B4
Control: B3, B4, B5 are dead. A3 and B2 are almost dead.
Control: cats or something have grew in A5 with the fish. All controls have these nat like things. A2 is the only one that does not have these.
Wednesday, 3/2, DAY 13
ALL CONTROLS DIED. they were fixed.
A1 and B2 of experimental zebrafish died. they were fixated. The rest were fed.
Thursday, 3/3, DAY 14
ALL CONTROLS DEAD
Experimental: all died, only B4 is alive.
the original master mix that the fish came in might have been contaminated and why that tics grew in the control and salinity broths. the salinity might have staled the growth or killed the tics and whey the fish lived longer than the controls.
PURPOSE
The purpose of this experiment is to identify bacteria species that exist within the transect. Polymerase Chain Reaction (PCR) sequencing was used to amplify bacterial genomic DNA. Gel electrophoresis was also used to test the 16S gene. This particular gene is tested for because it possesses sequences of DNA that are particular to specific types bacteria. Confirming its presence allows us to check existing databases to match results with the genomes of existing bacterial species.
MATERIALS AND METHODS
Earlier in the semester, we had created a Hay Infusion with leaves from transects and this hay infusion culture was used to create agar plates with serial dilutions. Small samples were taken from the agar plate and placed in a sterile tube and incubated at 100 degrees for ten minutes in a heat block making sure it floated in water at the same time. Next, the samples were put in a centrifuge for 5 minutes at 13,400rpm. 20 micro liters of water was added to the tube and mixed during centrifugation. Finally, 5mcro liters of supernatant from centrifuge sample was transferred to the 16s PCR sequence and the tube was placed in the PCR machine using agarose gel. We selected the most visible gels (vile A and D) for sequencing. We used http://blast.ncbi.nlm.nih.gov to copy and paste our raw sequence in order to identify the bacteria.
MB43 (16s Sequence from Agar plate with Nutrient 10^-5):
GGNNNNNNNNNNNNNNNNANNNTGCAGTCGTACAGGTAGCCGTAANTTGCTCTCGGGTGACGAGTGGCGGACGGGTGANT MB43 GGNNNNNNNNNNNNNNNNANNNTGCAGTCGTACAGGTAGCCGTAANTTGCTCTCGGGTGACGAGTGGCGGACGGGTGANTAATGT
CTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTT
CGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTC
TGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCG
CAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTGTGGTTAAT
AACCGCAGCAATTGACGTTACCCGCANAANAAGCACCGGCTAACTCCGTGCCAGCANCCGCGGTAATACGGANGGTGCAAGCGTTA
ATCGGNAATTACTGGGCGTAAAAGCGCACGCAGGCGGTCTGTCAA GTCGGATGTGAAANTCCCCCGGGCTCAACCTGGGAACTG
MB44 (16s Sequence from Agar Plate with Nutrient and Tetracycline 10^-3):
NNNNNNNNNNNNNNNNCNNNNNNNNGACAGCCGAGCGGTAGAGATCTTTCGGGATCTTGAGAGCGNGCGNTACGGGTGCGGANC
NNNTGTGCAACCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCATTTGATATTG
AAAACTCCGGTGGATAGAGATGGGCACGCGCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCAGTGATCTTTAGGGGGCC
TGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGGTGA
GAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTATAGGGATAAACCTTTCCACGTGTGG
AAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATT
TATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGAAATCTCATAGCTTAACTATGAAACTGCCATTGATACTGCAGGT
CTTGAGTAAANGTANAAGTGGCTGGAATAAGTANTGTANCGGTGAAATGCATAGATATTACTTANAACACCNATTGCGANNCAGGTCAC
TATGNTTTAACTGACGCTGATGGACGAAAGCGTGGGGAGCGAACNGGATTANATACCCTGGGTAGTCCACGCCGTAAACNATGCTAA
CTCGTTTTTGGNCTTTAGGGTTCAGANACTAAACNAAAGTGATNAGTTAAGCCNCCTGGGGANTACGTTCGCAAGAATGAAACTCANA
GGAATTGAACGGGGGCCCGCACACCGGGGGATTATGTGGTTTANTNNNATNANTCNCANGGAACCNTACCANGCTAAATGGGNATTG
ANGGGTNNNNANTAGACTTTCTTCNANNNTTTCAANGNNCTNCATGGGTGGNNGNGNGCTNNNGCNNNNAAGNNNNNNNN
CONCLUSION AND FUTURE DISCUSSIONS
Using the blast website, the bacteria 13A was Variovorax Sp. ML3-12 16S ribosomal RNA gene, partial sequence while the bacteria in tune 13D was Chryseobacterium Sp. MH gene for 16S rRNA, partial sequence. According to http://blast.ncbi.nlm.nih.gov Chryseobacterium is a yellow-pigmented bacterium designated strain that was isolated from a lactic acid beverage. The strain had Gram-negative, non-motile, rod-shaped cells. It was strictly aerobic and chemo-organ tropic and grew at 5-30 degrees C and at pH 5-8. The Variovorax was described on the http://blast.ncbi.nlm.nih.gov as part of a study in which soil sample was isolated from a greenhouse. It was described as a gram-positive, non-spore forming, and a rod shaped bacterium with irregular light colonies. The characteristics I encountered for these bacteria are consistent with the characteristics that we observed in lab.
...
ALE
LAB 5 FEB 11, 2016
PURPOSE
The purpose of this lab is to examine and identify invertebrates that were found in the Berlese funnel collection (prepared the week before). By identifying these invertebrates we are able to understand our transect more. Another group actually dismounted our tube of 50:50 ethanol/water solution, so they had taken some of our sample. Also during this lab we were able to observe various Acoelomates, Pseudocoelomates, and Coelomates with the dissecting scope and various arthropods that were in large glass jars. However, most of today's lab was focused on identifying the invertebrates from our transect.
Materials and Methods
Berlese Funnel (prepared last week)
petri dishes
transfer pipettes
dissecting microscope
phone camera
computer for identification (hope.edu website)
Use dissecting microscope and hope.edu website to identify invertebrates in transect.
Data and Observations
Since we were using a dissecting microscope, it was a bit harder at first to see clearly our specimens. Once we figured out how to properly use the microscope, we took our tube and poured the liquid out into a few petri dishes. We looked around for specimens floating and once we located one, transferred it to another petri dish so we could focus on it. Each time we found a different specimen and these are listed below in the images. Since our solution was used, we were told to borrow others as well until we found 5 different species, and therefore do not know how many total are in the samples.
Error creating thumbnail: File missingArthropoda insecta 9mm in length, 1-2 in sample, the organism has 6 legs, and looks like a grasshopper, it is in order Orthoptera)Error creating thumbnail: File missingArthropoda insecta 5mm in length, 1-2 in sample, the organism is in the order Psocoptera, it is also called Plant Lice)Error creating thumbnail: File missingArthropoda insecta 3.75mm in length, 1-2 in sample, the organism is in the order Diptera, it is also called a fly)Error creating thumbnail: File missingArthropoda insecta 4mm in length, 1-2 in sample, the organism is in the order Collembola, it is also called a Springtail)Error creating thumbnail: File missingArthropoda insecta 2.25mm in length, 1-2 in sample, the organism is in the order Homoptera, and are a Cicada, Leafhopper, Scale, or Aphid)
Vertebrates in Transect
-Squirrel(Sciurus carolinensis): Eats trees and soil (dig)
-Mouse (Mus musculus): Eats green plants, water
-Raccoon (Chaetodon fasciatus): Eats small rodents, trash
-Sparrow (Aimophila notosticta): Eats insects, mud for nest
-Robin (Cinclidium diana): Eats worms, sticks/branches
Conclusions and Future Directions
There are multiple different invertebrates (including ones not identified), that were found in the transect. They all live in
unison together and can lead to what type of nutrients are available in the transect. In the future, I would use a direction microscope that has a larger magnification on it to get a better view of the invertebrates and lead to a better identification.
....
ALE
LAB 4 FEB 4, 2016
PURPOSE
The purpose of this lab is to examine the plants and fungi that were found in the transect. By being able to identify what plants and fungi, we will be able to understand their contributing part of the ecosystem more in-depth.
Materials and Methods
2 Ziploc bags
phone camera
50:50 ethanol/water solution
conical tube
screening material
scissors
tape
funnel
ring stand
40 watt lamp
foil
Collect and examine plants from the transect by visualization, and touch.
Data and Observations
Ziploc bags and cellphone cameras were used to collect and document samples from transect #2. We found an area with soft soil (everything was pretty soft since it had just rained/snowed) and picked up dead leaves for our leaf liter sample. We collected about 25-30 leaves (~500g). We also searched for representative samples from five plants and collected a seed, a flower bud, a bushel of flower petals, a long leaf, and a short leaf. The images of the organisms are below along with a map of where they were found. Also, every producre in the lab could be documented in the table at the end. Instead of the table, descriptions under each image include the information from the table and therefor the lab procedures.
Error creating thumbnail: File missingSeed taken from location #1 of transect. It can be described as small, round, dark brown, and 0.75cm in length. It has vascularization, and is a monocot. It has an outer layer casing. Its mechanism of reproduction is a seed. )
Error creating thumbnail: File missingFlower bulb taken from location #2 of transect. It can be described as trumpet shaped, have a white pink color, and is 0.6cm in length. It does have vascularization which means it also has a xylem and a phloem. Special structors include an outer layer casing and bulbs. Its mechanism of reproduction is a seed. )
Error creating thumbnail: File missingWhite flower taken from location #3 of transect. It can be described as small, oval, pink, and each pedal is 1.2cm in length. It does have vascularization which means it also has a xylem and a phloem. Special structors include branches. Its mechanism of reproduction is a seed. )
Error creating thumbnail: File missingLong green leaf taken from location #4 of transect. It can be described as long, slender, bright green, monocot, and 26cm in length. It does have vascularization which means it also has a xylem and a phloem. It does not have any visible special structors in this sample. Its mechanism of reproduction is a seed. )
Error creating thumbnail: File missingSmall green leaf taken from location #2 of transect. It can be described as heart shaped, dark green, dicot, and is 9.7cm in length. It does have vascularization which means it also has a xylem and a phloem. This sample has a stem present on it. Its mechanism of reproduction is a seed. )
Fungi sporangia are black, globe like structures that hold spores. They are important because when the spores are released they gather food for the fungi.
Observed Samples
1. Zygomycota- lichen
2. Ascomycota- bread mold
3. Not able to be seen
The bread mold at 40X under the dissecting microscope.)
Conclusions and Future Directions
There were 5 different plant samples that were found on the transect, and documented but there are a lot more that have not been documented yet either. There are also mold observed through a petri dish. I would want to compare that to a physical piece of molded bread in the future and compare what stage of moldage the two specimens are at.
....
ALE
LAB 3 JAN 28, 2016
PURPOSE
The purpose of this lab is to see what organisms are found in the hay infusion. We will be able to see if they are gram positive or negative, their motility, and their resistance to tetracycline.
MATERIALS AND METHODS
Hay Infusion Culture (*prepared previous week)
Latex Gloves
Microscope
(8) Slides and slide covers
Transfer pipettes
Dichotomous Key (*aid in identifying microorganisms)
Crystal Violet
Distilled water
Alcohol Decolorizer
Iodine
Safranin
Diffusion was used to create isolated colonies, which were then looked at to see growth.
DATA AND OBSERVATIONS
Hay Infusion after two weeks: There was still no order coming from the infusion, but half of the water had evaporated. There is almost nothing left in there, it primarily looks like dirty water. There is some dirt at the bottom, however the top layer has also extremely reduced. I hypothesis that there was not enough in the Hay Infusion that the organisms died, and the water evaporated from the laboratory classroom lights and the air could have been very dry this past week, that the air needed the moisture from the hay infusion. We would have growth on the agar plates because there are nutrients on the agar plates but there are no longer nutrients in the Hay Infusion Culture.
The Image of Table 1 from the lab manual filled in for information from Transect 2's serial dilution results. Since the serial dilution was done in micro letters, the colonies on the plate were divided by 100 before being converted over to colonies/mL. This was done to remain in the same unit.
You can see more colonies on the plate without the antibiotic than with the antibiotic. This indicated that there was bacteria on the plates that were susceptible to the tetracycline anitbotic. Ttetracycline decreases the amount of bacteria but not fungi on the plates. However, no fungi was fund on the plates. There were also less colonies the more diluted plates. There was nothing found on the 10^-7, 10^-9, 10^-5 + tet, 10^-7 + tet, and 10^-9 + tet plates. At this part of the lab there is no indication how many species were unaffected by the tetracycline. By the looks of the colonies on the 10^-3 +tet plate (the only plate with tet that had colonies grow on it), it has about four different colonies on the plate.
Mechanism of Tetracycline
Tetracycline has three ways of resistance, they are tetracycline efflux, ribosomal protection, and tetracycline modification.Tetracycline efflux is an efflux gene in gram-negative bacteria that represses the tetracycline. The ribosomal protection works the same way. Tetracycline modification is very rare, and is not fully understood by the clinical field (Speer, 1992). A wide variety of bacteria are sensitive to tetracycline. Examples include both gram positive and negative bacteria, but especially: chlamydiae, mycoplasmas, rickettsiae, and protozoan parasites (Chopra, 2001).
The tetracycline killed a lot of the bacteria present, but not all. In the future, the dilution wold be minimized because it minimized so much that there was no growth on the 10^-7 and 10^-9 slides.
References
Chopra, I., & Roberts, M. (2001, June 6). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Retrieved February 04, 2016, from http://www.ncbi.nlm.nih.gov/pmc/articles/PMC99026/
Speer, B. S., Shoemaker, N. B., & Salyers, A. A. (1992, October 5). Bacterial resistance to tetracycline: Mechanisms, transfer, and clinical significance. Retrieved February 04, 2016, from http://www.ncbi.nlm.nih.gov/pmc/articles/PMC358256/
PURPOSE
The purpose of the experiment is to identify microorganism growing on the surface, middle, and bottom of a Hay Infusion Culture, while considering the biotic and abiotic factors residing in each level of the culture, and to determine what those organisms might need to survive.
MATERIALS AND METHODS
Hay Infusion Culture (*prepared previous week)
Latex Gloves
Microscope
(6) Slides and slide covers
Transfer pipettes
Dichotomous Key (*aid in identifying microorganisms)
DATA AND OBSERVATIONS
They hay infusion did not smell like anything. There was some mol and what looked like branches on the top of the hay infusion. The center was clear, and has the ability to bee seen through. The bottom section of the hay infusion was a dark/dirty mustard yellow. It also looked like there were some articles at the bottom of the container.
Organisms might move closer or further away from the top of bottom of the container would be determined on how it received their nutrients. If a plant matter organism used photosynthesis to receive energy, then it would most likely exist towards the top of the surface to receive maximum exposure from the sun/light. A protists organism might revive its nutrients from the milk protein that settled at the bottom of the container, and therefore be found towards the bottom of the hay infusion container.
If the presence of photosynthetic microorganisms such as algae are present in the culture, then it is likely that algae will exist closest to its surface for maximum exposure to the sun. Also, if protists reside within the Hay Infusion Culture, then it is likely that they will be found near its most bottom layer where the milk protein has settled.
Error creating thumbnail: File missingSide view of Hay Infusion Culture after adding milk protein and allowing to settle for a weekError creating thumbnail: File missingAerial view of Hay Infusion Culture after adding milk protein and allowing to settle for a week. There are molds present at the surface level of the culture
Diatoms meet all the needs of life as described on page 2 of the Freeman text in that it 1. is comprised of cells, or more specifically, it's unicellular 2. with cell walls 3. use chlorophyll to harvest energy from the sun (photosynthesis) 4. able to adapt to their environment (i.e. forming stalks to attach to water surface) 5. Can grow by forming larger colonies 6. has an oogamous sexual reproduction cycle). (Can be seen at top of the page)
If the Hay Infusion Culture had been allowed to grow for an additional two months, the microorganisms that are in the Hay Infusion may have been able to reproduce. Or there may not be anything growing because there si a lack of nutrients in the culture, and the microorganisms died. This would either lead to an increased competition for resources and a lab-friendly window into a microscopic survival of the fittest scenario, or after 2 months nothing will be there to observe.
The purpose of this experiment is to observe and describe the topograhic, biotic, and abiotic characteristics of a 20 by 20 foot transect on American University's Main Campus by creating a Hay Infusion Culture, or lab-friendly ecosystem.
MATERIALS AND METHODS
1 Gallon Ziplock Bag
Latex Gloves
Flashlight (*transect observed after dark)
Camera/camera phone
Glass Jar (w/ 1L capacity) with lid
500ml of purified water
0.1 gram of dried milk (*sustenance for living organisms in hay infusion culture)
Biotic components of transect:
-leaves
-dry soil: closer to the edge of the transect closest to the walking path,
-wet soil: closer to the river
multiple smaller dead trees scattered throughout the transect,
scattered leaves through transect and in the river
river
mold on the rocks in the river
multiple rocks in the river
river water
Abiotic Factors of transect:
-None present/directed towards transect.
CONCLUSIONS AND FUTURE DIRECTIONS
Transect 2 contained a great deal of water, soil, moss, algae, and leaves. Since the transect was looked at in the mist of winter, there was a lot of the transect was dead. I believe that changing the temperature of the location of the transect, will affect the live organisms that were able to live in the winter conditions.
....
ALE