User:Saroj Pandey/Notebook/SNP PCR optimization/2014/10/02
 Project name
|
 Main project page Previous entry Next entry
|
PCR with different primer combinations• Genomic DNAs were used as templates to amplify different regions of DNA including the taste SNP   Primer combinations 1. Product size: 510bp [gaF + Gfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC 2. Product size: 510bp [gaF + Cfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGG 3. Product size: 522bp [Gff(F) + gaR] Gff(F): GGGATGTAGTGAAGAGGCAGG gaR: GCATCCCAGAAGAAACCAGA 4. Product size: 522bp [Cff(F) + gaR] Gff(F): GGGATGTAGTGAAGAGGCAGC gaR: GCATCCCAGAAGAAACCAGA 5. Product size: 235bp [Cfb(F) + Gfb(R)] Cfb(F): GGTGGCAACCAGGTCTTTAG Gfb(R): CAATCACTGTTGCTCAGTGC 6. Product size: 235bp [Cfb(F) + Cfb(R)] Cfb(F): GGTGGCAACCAGGTCTTTAG Cfb(R): CAATCACTGTTGCTCAGTGG 7. Product size: 161bp [Gff(F) + Cff(R)] Gff(F): GGGATGTAGTGAAGAGGCAGG Cff(R): GATGGCTTGGTAGCTGTGGT 8. Product size: 161bp [Cff(F) + Cff(R)] Cff(F): GGGATGTAGTGAAGAGGCAGC Cff(R): GATGGCTTGGTAGCTGTGGT
Observation • [gaF+Gfb(R) and gaF+Cfb(R)] : Allele specific reverse primers showed bands with the corresponding templates just above 500bp. • [Gff(F)+gaR and Cff(F)+gaR] : Allele specific forward primer produced an expected specific band only with non-taster template but not with the taster one. Rather a thick bright band was seen at 100bp with taster template. • [Cfb(F)+Gfb(R) and Cfb(F)+Cfb(R)] : Allele specific reverse primers also worked with a different forward primer producing shorter bands (235bp) • [Gff(F)+Cff(R) and Cff(F)+Cff(R)] : Allele specific forward primers produced similar bands with both templates and were unable to distinguish between the two.
• Allele specific reverse primers when combined with a non-specific common forward primer are able to differentiate the SNPs. • There might have been pipetting error for different results seen with allele specific forward primers or they might not be the right primers to differentiate the taste SNPs.
| |
