User:Lu Wang/Notebook/Team Allergy/2010/07/07

Project name

Main project page Previous entry      Next entry

Overview Yesterday, we ended by transforming pKannabil and pHannibal into E. coli and running a diagnostic digest of digested allergen panel. Yesterday's plates did not grow, and the diagnostic digest did not have good results. Today, we will be redoing diagnostic digests of the allergen panel plasmids to see if we can see our desired bands (300 bp and 3200) and re-transforming pKannabil and pHannibal. If the digested allergen panel runs correctly on a gel, then we will send the plasmids off for sequencing. If nothing gel does not run correctly, then we will go back to re-digest V0120 with a death gene insert instead of YFP and ligate allergen inserts, transform, miniprep, and see if we get the correct insert. **If some run correctly and some did not, we will collect more samples from our culture plates for the allergens that did not work and redo the digests until we find a sample with the correct plasmid. If the pKannabil and pHannibal plates grow, then we will miniprep to purify the plasmids containing the PDK intron, PCR the intron, and purify the intron. Today, we are also running the PDK intron obtained yesterday to see if it is the correct length. First thing tomorrow, we will culture E. coli containing plasmids for our allergen panel to obtain more plasmids. Procedures For pKannabil and pHannibal: Electronic Gel Electrophoresis of PDK introns (from PCR reaction yesterday, PCR off DNA from the eluted vectors) Re-grow E. coli containing pKannabil and pHannibal plasmids Culture colonies Miniprep colonies PCR for PDK intron Diagnostic Gel to check for correct length Repeat PCR of PDK intron using different Tm (gradient pcr) For Allergen panel Digest of Plasmids containing allergen inserts Diagnostic Gel Collect additional samples for allergens that did not work Results For pKannabil and pHannibal Transformation of pHannibal pKannibal This transformation we performed slightly differently from the one yesterday. This protocol is nicknamed the "quick and dirty transform." The transformation we started yesterday of pH and pK didn't work (no growth on either plate). Quick and Dirty Transform: Mix 2ul 10x {pHannibal, pKannibal} 20ul Turbo E. Coli 220ul SOC Broth Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow PCR of PDK intron PCR of PME3 and PAL2 saw no bands from last night's pcr so we re ran it Annealing Temp: 69C Extension Time: 30 sec 2 reactions Name Amount (uL) 10mM dNTPs 1 5x Phusion Buffer 10 Phusion Polymerase .5 Arabadopsis Genomic DNA 7 ng Fwd/Rev Primer .5 uM each (1uL 50x) Water 35.5 Concentrations: PDK:46.5 ng/uL & 36.5 ng/uL Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3: OLIGO start len tm gc% any 3' seq LEFT PRIMER 4229 20 51.11 30.00 8.00 3.00 CCAATTGGTAAGGAAATAAT RIGHT PRIMER 5021 20 61.95 45.00 6.00 0.00 TTCGAACCCAATTTCCCAAC See Gel Image Below: ladder, lane 3 and 5 are pdk intron Gradient PCR Annealing Temps: 50,55,60,65 Extension Time: 30 sec 8 reactions Name Amount (uL) 10mM dNTPs 1 5x Phusion Buffer 10 Phusion Polymerase .5 Arabadopsis Genomic DNA 7 ng Fwd/Rev Primer .5 uM each (1uL 50x) Water 35.5 Concentrations: PDK: 12.7 ng/uL Remaining steps Culture colonies Miniprep colonies PCR for PDK intron Diagnostic Gel to check for correct length Repeat PCR of PDK intron using different Tm. For Allergen panel Digest of Plasmids containing allergen inserts Digested with Xba and Pst using Fast Fermentas digest protocol. Added 3 μL of DNA and 17μL of master mix (with 0.5μL of each restriction enzyme) to each reaction. Diagnostic Digest Digestions Digestion Reactions LTPS (3) LTPA (3) GRES (3) GREA (3) Bet1S Bet1A Bet1.2S Bet1.2A DNA (~200 ng) (~200 ng)|align="center" | (~200 ng)|align="center" | (~200 ng)| FD Buffer (10x) 2 2 2 2 diH2O x x x x Xba1 1 1 1 1 Pst1 1 1 1 1 Ran on a gel File:Insert image Out of the 24 lanes, 6 were successful. Of the 8 allergens, 3 were successful. Samples of LTP sense, Betv1 sense, and Ger sense had one band at around 3kbps and one band at 300bps. The other genes had one band at 3kbps and additional longer bands on the scale of twice or three times the length of the plasmid. For the allergens that did not work, we will go back to our bacteria plates and sample 5 additional colonies for each allergen, grow up 10 mL overnight cultures, and miniprep so that we can redo the diagnostic digest. We are hoping that a larger sample size would allow us to find colonies with the correct plasmid. Remaining Steps Collect additional samples for allergens that did not work Culture them Miniprep Diagnostic Digest and Gel