User:Lindenb/Notebook/UMR915/20101104

From OpenWetWare
Jump to navigationJump to search

20101103        Top        20101105       


SOAPAligner

testing soap aligner: 

 soap2.20release/soap -a xx_3_1.fastq.gz -bxx_3_2.fastq.gz -D hg18.fa.index -o ~/soap_results.data -2 ~/unpaired.data
 File Error: unrecognized file

hum... it doesn't like the gzipped fastq ?... :-/ unzippinf...


/usr/local/package/soap2.20release/soap -a XX_3_1.fastq -b XX_3_2.fastq -D hg18.fa.index -o soap_results.data -2 unpaired.data -m 200 -x 600 

Begin Program SOAPaligner/soap2
Thu Nov  4 11:18:24 2010
Reference: hg18.fa.index
Query File a: 4366_3_1.fastq
Query File b: 4366_3_2.fastq
Output File: soap_results.data
             unpaired.data
Load Index Table ...
Load Index Table OK
Begin Alignment ...
131072 ok   86.16 sec
262144 ok   84.23 sec
393216 ok   93.31 sec
524288 ok   90.48 sec
(...)
70254592 ok   62.22 sec
70385664 ok   58.87 sec
70516736 ok   59.30 sec
70647808 ok   58.74 sec
70778880 ok   59.80 sec
70909952 ok   55.67 sec
71041024 ok   55.21 sec
71172096 ok   52.78 sec
71303168 ok   54.85 sec
71434240 ok   59.92 sec
71473618 ok   17.14 sec
Total Pairs: 35736809 PE
Paired:      14641084 (40.97%) PE
Singled:     34692762 (48.54%) SE
Total Elapsed Time:        33175.70
      - Load Index Table:     14.96
      - Alignment:         33160.74

SOAPaligner/soap2 End
Thu Nov  4 21:57:26 2010

Results

 [lindenb@srv-clc-02 lindenb]$ ls -lah soap_results.data unpaired.data 
 -rw-r--r-- 1 lindenb users 4.8G Nov  4 21:57 soap_results.data
 -rw-r--r-- 1 lindenb users 5.7G Nov  4 21:57 unpaired.data

 file soap_results.data unpaired.data 
soap_results.data: ASCII text
unpaired.data:     ASCII text
[lindenb@srv-clc-02 lindenb]$ more soap_results.data 
IL36_4366:3:1:1056:15626/1	CCAAGGGAGCTTATTAGTCCCTTCCACCATGTGAGGACGCAAGAAGGCATCATC	9305(3-=<8)<?/9:+48?;(5:6=@C:;4<==-?;C9<?8<ABA3CBA?A5E	1	a	54	-	chr7	36927164054M	54
IL36_4366:3:1:1056:15626/2	GAAATGCCGTCTTGCTTGAAAAGTCCTTCTTAACTCTCCCACAAGTCACTCTCT	E-E4EEAE?59>=C9A7?A:=E?@A:;)4:<8488=;B<=6*.2;*8<+4)=98	1	b	54	+	chr7	36926895054M	54
IL36_4366:3:1:1059:7264/1	TCTTTCTTCAGCTTCTTGGGCGAAACAGGGAGTCTTTCCTGTGGACTCAGCTTG	8437CE=AA=+C<?>:36.11@@@.CFBFA9<B>@==@>C;55;A<-1>;F;-?	2	a	54	-	chr17	40983027054M	54
IL36_4366:3:1:1059:7264/2	TCTTCAAGGGTCTCTGGATTTTGAGTTTCGGGCTCTAGATGGAATTGAGAAGGT	D>DD7DB8BAA-BD?@=94B4AAAA3>@AD<;6-6=DDA8*=7>4)<=<<9<3=	2	b	54	+	chr17	40982790054M	54
[lindenb@srv-clc-02 lindenb]$ more unpaired.data 
IL36_4366:3:1:1053:17041/1	AGACAGCAGTTAGTTGGTTGGTGAGTTCTTATCCATTCTGCTGTTCTGTATCTT	=<@=;@B>;30</C99*>0@=D4E7>:>8@+1@8BDD:ABAC@<CDABDBE8DB	4	a	54	-	chr4
	92885278	2	A->41T3	G->9T-13	54M	9G31A12
IL36_4366:3:1:1053:7122/1	GGCAGTGCCTCTACCCTCCTCCTTAAGTTTCTATGGTCCCTGCTGCTCCTGGCC	5)8(6+8?@>@--9?;,4>3=E?A@@8@6;?;+?B*?;?@;5A@'>2>:>40>A	1	a	54	-	chr6
	31233127	0	54M	54
IL36_4366:3:1:1053:7122/2	GAAAGAGACAGACTGAGAGGGGCTCTGAGGCTTTACTCATACTTTCAGGATTCT	$6&')$'&4926<-..6%,%-)%68/8=84+-4<(-*/*.6(52*2.D/&-5/%	1	b	54	+	chr6
	31233072	0	54M	54

Galaxy

wget "http://bitbucket.org/galaxy/galaxy-dist/get/tip.zip"
unzip tip.zip
cd galaxy-dist
sh setup.sh

Copying datatypes_conf.xml.sample to datatypes_conf.xml
Copying reports_wsgi.ini.sample to reports_wsgi.ini
Copying tool_conf.xml.sample to tool_conf.xml
Copying tool_data_table_conf.xml.sample to tool_data_table_conf.xml
Copying universe_wsgi.ini.sample to universe_wsgi.ini
Copying tool-data/alignseq.loc.sample to tool-data/alignseq.loc
Copying tool-data/annotation_profiler_options.xml.sample to tool-data/annotation_profiler_options.xml
Copying tool-data/annotation_profiler_valid_builds.txt.sample to tool-data/annotation_profiler_valid_builds.txt
Copying tool-data/bfast_indexes.loc.sample to tool-data/bfast_indexes.loc
Copying tool-data/binned_scores.loc.sample to tool-data/binned_scores.loc
Copying tool-data/blastdb.loc.sample to tool-data/blastdb.loc
Copying tool-data/bowtie_indices.loc.sample to tool-data/bowtie_indices.loc
Copying tool-data/bowtie_indices_color.loc.sample to tool-data/bowtie_indices_color.loc
Copying tool-data/encode_datasets.loc.sample to tool-data/encode_datasets.loc
Copying tool-data/liftOver.loc.sample to tool-data/liftOver.loc
Copying tool-data/maf_index.loc.sample to tool-data/maf_index.loc
Copying tool-data/maf_pairwise.loc.sample to tool-data/maf_pairwise.loc
Copying tool-data/microbial_data.loc.sample to tool-data/microbial_data.loc
Copying tool-data/phastOdds.loc.sample to tool-data/phastOdds.loc
Copying tool-data/quality_scores.loc.sample to tool-data/quality_scores.loc
Copying tool-data/regions.loc.sample to tool-data/regions.loc
Copying tool-data/sam_fa_indices.loc.sample to tool-data/sam_fa_indices.loc
Copying tool-data/srma_index.loc.sample to tool-data/srma_index.loc
Copying tool-data/twobit.loc.sample to tool-data/twobit.loc
Copying tool-data/shared/ucsc/builds.txt.sample to tool-data/shared/ucsc/builds.txt
Creating database/files
Creating database/community_files
Creating database/tmp
Creating database/compiled_templates
Creating database/job_working_directory
Creating database/import
Creating database/pbs
Creating static/genetrack/plots
Creating tool-data/shared/jars
One or more of the python eggs necessary to run Galaxy couldn't be
downloaded automatically.  You can try building them by hand (all
at once) with:
  python scripts/scramble.py
Or individually:
  python scripts/scramble.py Mako
  python scripts/scramble.py Babel
  python scripts/scramble.py Whoosh
  python scripts/scramble.py Tempita
  python scripts/scramble.py Cheetah
  python scripts/scramble.py lrucache
  python scripts/scramble.py sqlalchemy_migrate
  python scripts/scramble.py NoseHTML
  python scripts/scramble.py pexpect
  python scripts/scramble.py bx_python
  python scripts/scramble.py PasteDeploy
  python scripts/scramble.py WebHelpers
  python scripts/scramble.py docutils
  python scripts/scramble.py numpy
  python scripts/scramble.py pysqlite
  python scripts/scramble.py Beaker
  python scripts/scramble.py SVGFig
  python scripts/scramble.py SQLAlchemy
  python scripts/scramble.py simplejson
  python scripts/scramble.py WebError
  python scripts/scramble.py python_lzo
  python scripts/scramble.py wchartype
  python scripts/scramble.py twill
  python scripts/scramble.py Routes
  python scripts/scramble.py elementtree
  python scripts/scramble.py decorator
  python scripts/scramble.py pycrypto
  python scripts/scramble.py Paste
  python scripts/scramble.py wsgiref
  python scripts/scramble.py nose
  python scripts/scramble.py amqplib
  python scripts/scramble.py WebOb
  python scripts/scramble.py PasteScript

tomcat already running on port 8080: edit universe_wsgi.ini and change 

port=8020

but problem with the proxy

GEM

> gem-mapper
Welcome to GEM-mapper build 544 (beta) - (2009/10/07 02:50:12 GMT)
 (c) 2008-2010 Paolo Ribeca <paolo.ribeca@gmail.com>
************************************************************************
* WARNING: this is a beta version, provided for testing purposes only; *
*  check for updates at <http://www.paoloribeca.net/software/GEM>.     *
************************************************************************
Names of index, input and output file are mandatory
Usage:
 gem-mapper
  -I <index_prefix>               (mandatory)
  -c|--colorspace                 (index is colorspace-encoded)
  -e|--emulate-complement         (for indices lacking it)
  -i <input_file>                 (mandatory, FASTA or FASTQ)
  -q|--quality-format 'ignore'|'phred'|'solexa'
                                  (mandatory with FASTQ input)
  --reads-per-block <number>      (default=10000)
  -o <output_prefix>              (mandatory)
  -t <thread_number>              (default=1)
  -m <max_mismatch_number>        (default=2)
  --mismatch-alphabet <symbols>   (default="ACGT")
  -Q|--quality-model 'gem'|'flat' (default='gem')
  --gem-quality-threshold <number>
                                  (default=26, that is e<=2e-3)
  -d|--decoding-threshold 'all'|<number>
                                  (default=10)
  --filtering-threshold <number>  (default=40)
  --max-indel-length <number>     (default=5)
  --disable-accelerators          (for debugging purposes)
  -h|--help                       (print usage)

no paired-end sequencing ? 

gem-mapper -i XXXX_1.fastq -o gemout -I gemhg18 -q phred
Welcome to GEM-mapper build 544 (beta) - (2009/10/07 02:50:12 GMT)
 (c) 2008-2010 Paolo Ribeca <paolo.ribeca@gmail.com>
************************************************************************
* WARNING: this is a beta version, provided for testing purposes only; *
*  check for updates at <http://www.paoloribeca.net/software/GEM>.     *
************************************************************************
Thu Nov  4 12:46:54 2010 -- Loading index (likely to take long)... done.
Thu Nov  4 12:46:58 2010 -- Loading locations... done.
Thu Nov  4 12:46:58 2010 -- Pre-scanning input file... done
                         --  (FASTQ, it contains 35736809 reads).
Thu Nov  4 12:48:47 2010 -- #0 sequences processed
Thu Nov  4 12:48:52 2010 -- #10000 sequences processed
Thu Nov  4 12:48:57 2010 -- #20000 sequences processed
(...)
Thu Nov  4 17:37:57 2010 -- #35690000 sequences processed
Thu Nov  4 17:38:02 2010 -- #35700000 sequences processed
Thu Nov  4 17:38:06 2010 -- #35710000 sequences processed
Thu Nov  4 17:38:11 2010 -- #35720000 sequences processed
Thu Nov  4 17:38:15 2010 -- #35730000 sequences processed
Thu Nov  4 17:38:18 2010 -- #35736809 sequences processed

results

 ls -lah gemout.0.map 
-rw-r--r-- 1 lindenb users 6.0G Nov  4 17:38 gemout.0.map

IL36_4366:3:1:1053:17041/1	AAGATACAGAACAGCAGAATGGATAAGAACTCACCAACCAACTAACTGCTGTCT	BD8EBDBADC<@CABA:DDB8@1+@8>:>7E4D=@0>*99C/<03;>B@;=@<=	0:1:3	chr1:F180110233T45@18/1,chr1
3:F36979712C13C52@65/2,chr6:R120088529T13T45@52/2,chr4:R92885278T13C45@52/2
IL36_4366:3:1:1053:7122/1	GGCCAGGAGCAGCAGGGACCATAGAAACTTAAGGAGGAGGGTAGAGGCACTGCC	A>04>:>2>'@A5;@?;?*B?+;?;6@8@@A?E=3>4,;?9--@>@?8+6(8)5	1:0:0	chr6:R31233127@0/0
IL36_4366:3:1:1056:15626/1	GATGATGCCTTCTTGCGTCCTCACATGGTGGAAGGGACTAATAAGCTCCCTTGG	E5A?ABC3ABA<8?<9C;?-==<4;:C@=6:5(;?84+:9/?<)8<=-3(5039	1:0:0	chr7:R36927164@0/0
IL36_4366:3:1:1056:1782/1	AAGATTCCAAATGGAAAAATAAAACTTTTGCCTTCTACTTGTTATTTTAGCACT	:8A*@>$6<<AB>B?;?(;BB94,5BB;B<*2),)<6+@3>(88/-@@?8;97%	0:0:1	chr18:R3177698C4C54@13/2
Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Lindenb/Notebook/UMR915/20101104&oldid=470628"