User:Jarle Pahr/PCR

From OpenWetWare
Jump to: navigation, search

^^ Tips on getting one band, by using one band of a first PCR as template for a second PCR:

PCR patent:,683,202.PN.&OS=PN/4,683,202&RS=PN/4,683,202

For low-GC templates, some regions of the amplicon may have a melting temperature lower than the extension temperature, causing denaturation during the extension step and failure of the PCR reaction. (


Polymerase Speed (min/kb) Fidelity Supplier Reference 5'-3' Exonuclease? 3'-5' exonuclease (proof reading) Strand displacement? Overhang? Amplicon size
Taq 1 Example ex Yes No Yes 3'-A
Phusion 0.25-0.50 Example NEB No Yes No No
Pfu 2 Example Example No Yes No
Q5  ? Example NEB


BiteSize Bio - The best polymerases of 2008:

For a comparison of various polymerases, see

Phusion polymerase

Note on Phusion polymerase:

Quotes from the protocol:

The final concentration of each primer in a reaction using Phusion DNA Polymerase may be 0.2–1 μM, while 0.5 μM is recommended.

During thermocycling, the denaturation step should be kept to a minimum. Typically, a 5–10 second denaturation at 98°C is recommended for most templates.

Annealing: Annealing temperatures required for use with Phusion tend to be higher than with other PCR polymerases. The NEB Tm calculator should be used to determine the annealing temperature when using Phusion. Typically, primers greater than 20 nucleotides in length anneal for 10–30 seconds at 3°C above the Tm of the lower Tm primer. If the primer length is less than 20 nucleotides, an annealing temperature equivalent to the Tm of the lower primer should be used. A temperature gradient can also be used to optimize

[Phusion polymerase]

Finnzyme Tm calculator for use with Phusion:

Strand displacement:


Home-grown polymerase

Optimization of Taq DNA polymerase enzyme expression in Escherichia coli.:

Purification and characterization of Taq polymerase: A 9-week biochemistry laboratory project for undergraduate students.:

PCR programs




Sequences for SLIC

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
rrnB p1_74bp_FWD 40 agccgggcgatgccaaccggGTTGCGCGGTCAGAAAATTA For amplification of 74 bp promoter fragments plus SLIC linkers
rrnB p1_74bp_REV 39 ctccattattattgtacatgAGTGGTGGCGCATTATAGG  ?
rrnB_p1_long_FWD 20 agccgggcgatgccaaccggGTATCCTACGCCCGTGGTTA ? For amplification of 389 bp fragment plus SLIC linkers. Use together with rrnB p1_74bp_REV
GreA_60bp_FWD 40 agccgggcgatgccaaccggGGCGCAACGCCCTATAAAGT  ?
GreA_long_FWD 40 agccgggcgatgccaaccggTCACCCTTAAGTACGCCGTT 59 50.00 For amplification of 399bp fragment plus SLIC linkers.
GreA_60bp_REV 45 ctccattattattgtacatgATAGTCATTTTACCCTGAAGTTCCC ?

Sequences for amplification from pSB-M1g

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
RBS-GFPstart 20 ATGGAGTCATGAACATATGG 56 40 For amplification from pSB-M1g, starting from RBS. Somewhat low GC content, and does not pass 5' end stability check in Clone Manager.
pSB-REV1 20 TCAAGGATGTGGATCTGCTG 57(2)/64.4(1)/57.3(3) 50 For amplification of vector backbone from pSB-M1g. Binds at same site as SeqMG1, between OriT and AgeI. Amplicon includes Colony PCR FWD2 site, but not the Seq5 site.
pSB-REV2 20 CCGGCTTTCTTAGACACTCT 60.5(1) 50 For amplification of vector backbone from pSB-M1g. Binds at beginning of SLIC linker B. Includes Colony PCR FWD2 and Seq5 sites, but not AgeI. Triggers primer dimer warning in Clone Manager.
GFP-END-LVA-EcoRI-BamHI-REV 72 agaggatcccttaagttaagctactaaagcgtagttttcgtcgtttgctgcTTTGTATAGTTCATCCATGCC 59.4(1) (target sequence) Primer for amplification of end region of GFP from pSB-M1g with addition of LVA-tag plus EcoRI (italic) and BamHI (bold) sites.

Sequences for restriction-ligation cloning (RL cloning)

Name Length (bp) Sequence (PCR target sequence in bold) Tm, Target seq. (C) [calculated] GC (% / bp) Comment
rrnB p1_74bp_FWD_R 28 caaccggtGTTGCGCGGTCAGAAAATTA
rrnB p1_74bp_REV_R 27 gtacatgtAGTGGTGGCGCATTATAGG
rrnB P1_74bp_mutdis_REV gtacatgtAGTGGTGGTATATTATAGG

Sequences for Ligation-independent cloning (LIC):

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
rrnB74bpLIC_FWD 36 gccgcgcggcagcctgGTTGCGCGGTCAGAAAATTA
rrnB75bpLIC_REV 33 caagaagaacccctAGTGGTGGCGCATTATAGG
GreA_60bpLIC_FWD 36 gccgcgcggcagcctgGGCGCAACGCCCTATAAAGT

For SacII-based LIC sequence, see

Tm notes:

  • 1: Finnzyme/Thermo Scientific Tm Calculator
  • 2: Clone Manager
  • 3: Primer 3

BioBrick sequences:


Average molecular weight: 487 g/mol

Oligomer annealing

PCR techniques

"sticky end PCR method": Can be used to generate PCR products with restriction site-compatible overhang. Can be used to clone fragments which contain the same restriction site(s) as the vector.


Colony PCR

Colony PCR can be performed with several amplification strategies:

  • Insert-specific primers only: For verifying presence of insert directly. Should only give amplicon if insert is present. However, if the insert was tranferred from one vector to another, colony PCR will give a positive result (amplicon) even if the vector is wrong
  • Backbone-specific primers: Altough the presence of the insert can't be confirmed directly in this way, it may still be useful to do colony PCR with primers specific to the regions in the vector flanking the insert, checking that the new vector gives the expected amplicon size.
  • Combination of insert- and backbone-specific primers: Useful in the case of short insert sequences. The presence of the insert can be verified directly while giving a longer, selectable amplicon size. Use the parent vector as a negative control template.

Emulsion PCR



Digital PCR

Inverse PCR

PCR program design

Advantages of lower annealing temperature:

  • Possible higher yield
  • Shorter run time

Disadvantages of lower annealing temperatures:

  • Higher danger of mis-priming and primer dimers
  • Longer run time.

For short amplicons, a two-step cycling program may be tried. Given denaturation at 95 C and annealing at 50-55 C, the polymerase may have time to produce a product during the ramping phase from annealing to denaturation.

Touchdown PCR


Primer Design

Optimization and troubleshooting

To do a quick, rough check on the thermocycling performance and corresponence between displayed and actual temperature, run a PCR program with a hold at 4 C at the end. Immediately after the display shows that 4C is reached and that the machine is holding the temperature, open the cover and feel the temperature of the heatblock. If it isn't cold, there is a significant time-lag/discorrespondence between the displayed and heatblock surface temperatures.

Purification of oligomers


Desalting: Standard purification procedure to remove by-products from synthesis.

Reverse-phase cartridge purification (Sigma:"RP1"). Separates truncated and full-length products on the basis of difference in hydrophobicity between full-length products with DMT protecting group present, and truncated sequences without DMT group. Unsuited for longer oligomers, as the proportion of DMT-containing truncated sequences increase with oligomer length. From Sigma website:

"As the oligo length increases, the proportion of uncapped products (truncated sequences bearing the DMT) tends to increase. These impurities will not be removed by RP1 and thus for longer oligos, HPLC or PAGE is recommended."

HPLC reverse-phase:

From Sigma website:

"The resolution based on lipophilicity will decrease with the length of the oligo. Therefore, RP-HPLC is usually not recommended for purifying products longer than 50 bases. Although longer oligos (up to 80 bases) can be purified using this method, the purity and yields may be adversely affected."


From Sigma website:

"This technique is recommended when a highly purified product is required. PAGE is the recommended purification for longer oligos (≥50 bases)."

Anion-Exchange HPLC:

From Sigma website:

"Anion- Exchange HPLC is limited by length (usually up to 40mers). The longer the oligonucleotide the lower the resolution on the Anion-Exchange HPLC column and thus the purity of the target oligo."

Comparison of calculated and reported Tm values

Oligomer Sequence Tm (C) [calculated] Tm (C) [Analytical] Supplier
GFP-END-FWD 65.6(1) 65.2 Sigma
GFP-END-REV 59.4(1) 58.9 Sigma
GFP-END-LVA-REV 84.5(1) 84.5 Sigma
rrnB p1_74bp_FWD agccgggcgatgccaaccggGTTGCGCGGTCAGAAAATTA 91.2(1) 91.3 Sigma
rrnB p1_74_bp_REV ctccattattattgtacatgAGTGGTGGCGCATTATAGG 75.7(1) 75.6 Sigma
GreA_60bp_FWD agccgggcgatgccaaccggGGCGCAACGCCCTATAAAGT 91.5 91.6 Sigma
GreA_60bp_REV ctccattattattgtacatgATAGTCATTTTACCCTGAAGTTCCC 74.5 74.5 Sigma
LacUV5_49bp_FWD AGCCGGGCGATGCCAACCGGgcaccccaggctttacactttatgcttccggctcg 95.0(1) 95.5 Sigma
LacUV5_49bp_REV CTCCATTATTATTGTACATGtccacacaTTatacgagccggaagcataaagtgta 80.3(1) 80.3 Sigma
pJP-1 seq5 CAGCGTGCGAGTGATTAT 60.6(1) 53.9 Macrogen
pJP-1 seq6 AGACCACATGGTCCTTCT 57.5(1) 53.9 Macrogen
SeqMG1 AGCAGATCCACATCCTTGAA 62.7(1) 56.4 Macrogen
rrnB_p1_long_FWD agccgggcgatgccaaccggGTATCCTACGCCCGTGGTTA 90.6(1) 85.1 Macrogen
GreA_long_FWD agccgggcgatgccaaccggTCACCCTTAAGTACGCCGTT 89.5(1) 84.0 Macrogen

Observations: For deliveries from Sigma Aldrich, Tm values from the Finnzymes Tm calculator and reported by Sigma are in good agreement. For deliveries from Macrogen, the reported Tm values systematically lower than the values calculated by Finnzymes Tm calculator - up to 6 degrees lower, and an average of 4,4 degrees lower. Does the synthesis process at Macrogen (impurities?) cause lower Tm values?


Comparison of PCR machines:

EppenDorf MasterCycler



DIY designs:



ABI Prism 7700:




