User:Jarle Pahr/Meat
Sequences for species identification:
For papers on species identification of meat products, see:
Authentication of species in meat products by genetic techniques:
http://link.springer.com/article/10.1007%2Fs00217-010-1417-1?LI=true#page-1
A set of degenerate primers was designed for amplification and sequencing of the cytochrome b (cyt b) gene of several species:
MEAT F: CGAGGCCTMTAYTAYGG MEAT R: ATTGAKCGTAGGATTGCGTA
PCR reactions were carried out in 50 uL volume with 100-300 ng DNA template. PCR program:
"3 min at 95C, then 35 cycles (30 s at 95C, 30 s at 50C, and 30 s at 72C) and a final extension step of 72C for 3 min." Genomic DNA was extracted from 30 mg muscle tissue, following the protocol of Roger and Bendich (Roger SO, Bendich AJ (1988) Extraction of DNA from plant
tissues. Plant Mol Biol Manual A6:1–10). For highly processed products, 150 mg sample was used. Sequencing was carried out using the same primers as for PCR. DNA amplification with the primers MEAT F/R gave an amplicon of 555 bp in all tested species.
Ilhak and Arslan. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique. Turk. J. Vet. Anim. Sci.
2007; 31(3): 159-163: http://journals.tubitak.gov.tr/veterinary/issues/vet-07-31-3/vet-31-3-3-0601-30.pdf
The primers used by Ilhak and Arslan were designed based on Lahiff (2001). Mol Cell Probes. 2001 Feb;15(1):27-35. Species-specific PCR for the identification of ovine, porcine and chicken species in meta and bone meal (MBM).
PCR was performed in 50 uL reaction with Taq polymerase.
An annealing temperature of 58 C was used for all primers. PCR program:
94 C 45 s, 58C 45 s and 72C 90 s. 30 cycles.
Agarose gel electrophoresis was performed with a 1.5 % agarose gel, loaded with 15 uL PCR product and run at 100 V for 2 h.
| Animal | Direction | Sequence | Position in reference sequence | Reference sequence accession |
|---|---|---|---|---|
| Bovine | FWD | GCCATATACTCTCCTTGGTGACA | 8107/812 | J01394 |
| Bovine | REV | 5’- GTAGGCTTGGGAATAGTACGA- | 8377/8357 | |
| Sheep | FWD | 5’- TTAAAGACTGAGAGCATGATA- 3’ | 71/91 | AF039171 |
| Sheep | REV | 5’- ATGAAAGAGGCAAATAGATTTTCG- 3’ | 295/272 | |
| Porcine | FWD | 5’- GCCTAAATCTCCCCTCAATGGTA- 3’ | 93/115 | AF039170 |
| Porcine | REV | 5’- ATGAAAGAGGCAAATAGATTTTCG- 3’ | 304/281 | |
| Cat | FWD | 5’- CATGCCTATCGAAACCTAACATAA- 3’ | 11101/11124 | NC_001700 |
| Cat | REV | 5’- AAAGAAGCTGCAGGAGAGTGAGT- 3’ | 11373/11351 | |
| Dog | FWD | 5’- GATGTGATCCGAGAAGGCACA- 3’ | 8821/8841 | NC_002008 |
| Dog | REV | 5’- TTGTAATGAATAAGGCTTGAAG- 3’ | 9142/9121 |
Detection of Adulteration and Identification of Cat’s, Dog’s, Donkey’s and Horse’s
Meat Using Species-Specific PCR and PCR-RFLP Techniques: http://www.ajbasweb.com/ajbas/2009/1716-1719.pdf
Abdel-Rahman et al. developed PCR and PCR-RFLP methods for identification of cat's, dog's, donkey's and horse's meat. The primers used were as follows:
| Name | Length (bp) | Sequence | Tm (C) [calculated] | Tm (C) [Analytical] | GC (% / bp) | Comment |
|---|---|---|---|---|---|---|
| Cat’s SSR FWD | CTCATTCATCGATCTACCCA | |||||
| Cat’s SSR REV | GTGAGTGTTAAAACTAGTACTAGAAGA | |||||
| Dog’s SSR FWD | GGAGTATGCTTGATTCTACAG | |||||
| Dog’s SSR REV | AGAAGTGGAATGAATGCC | |||||
| Horse/Donkey SSR FWD | TTCTGCTCTGGGTGTGCTACTT | From Abdel-Rahman et al. 2009 | ||||
| Horse/Donkey SSR FWD | CTACTTCAGCCAGATCAGGC | From Abdel-Rahman et al. 2009 | ||||
| Donkey’s and Horse’s cytochrome-b FWD | CCATCCAACATCTCAGCATGATGAAA | |||||
| Donkey’s and Horse’s cytochrome-b REV | GCCCCTCAGAATGATATTTGTCCTCA |
SSR = Simple Sequence Repeat= RFLP = restriction fragment length polymorphism
Amplicon sizes from cat, dog and donkey were 672 and 808 bp respectively. The Horse/Donkey SSR primer and cytochrome-b primer pairs yielded amplicons of 221 and 359 bp, respectively. The annealing temperatures used for the four primer pairs were 52, 52, 55 and 58 C, respectively. PCR was carried out as follows: Initial denaturation: 94°C for 4 min. Amplification: 35 cycles, 94°C for 60s, annealing temperature at 52-58 for 60s, extensiona at 72°C for 60s. Final extension at 72°C for 10 min.
See also:
http://nxseq.bitesizebio.com/articles/neigh-need-for-ngs-for-meat-testing-in-the-mane-pcr-is-enough/
