User:Ines Sofia Silva Vieira/Notebook/Bio Molec - caderno/2010/03/09

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Entry title

[edit] Gene e mRNA A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA



Compare as duas sequências (utilize o alinhamento blast online) Que diferenças encontra e qual a sua origem?

A sequência de mRNA é mais pequena que a de DNA o que significa que ocorreu splicing pós transcrição e esta sequência já não tem nem os intrões nem as porções não codificantes do genoma. Para além disso esta sequência codificante de mRNA contem uma 'cauda' de Adenina o que nos indica que a transcrição foi finalizada.

Onde se inicia a transcrição e porquê?


A transcrição inicia-se no iniciador onde seguidamente se irá ligar a polimerase e para isso tem de conter anteriormente a TATAbox e o elemento de reconhecimento TFIIB. Neste caso a transcrição inicia-se no nucleótido 546, alguns nucleótidos após a TATA box (que se encontra sem o primeiro T).

Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica?


A expressão génica só ocorre quando temos uma Met como iniciador e codão Stop a terminar.Convencionando o sentido 5'->3', temos três frames de leitura da mesma sequência. A primeira sequência genética(DNA genómico) possui diferentes quadros de leitura só que está interrompido por codões Stop sem que o primeiro exão metionina esteja presente ou então está presente mas existem muitos poucos aminoácidos e como tal não são codificadas proteinas, existe um caos. Mesmo tendo eventualmente um quadro de leitura 'fechado' para o DNAgenómico, como existem intrões, o código de leitura seria desviado sendo feita uma leitura diferente da do mRNA processado. Assim a sequência inicial apenas corresponde a uma leitura de DNA genómico não sendo comprometedora da sequência proteica. A sequência 2,por sua vez, correspondente ao RNA que já sofreu splicing já está bastante organizada e já não possui os intrões, sendo esta composta por exões que sao as zonas codificantes de uma proteína. Analisando esta região com atenção, vemos que contem uma sequência antes da Metionina que não está contida no DNA, são sequências de regulação essenciais.


Sequencia 1:


5'3' Frame 3 H I Y I Y I F S F L T R R F Stop S K Stop G E D Met L R T E V E F S S I L S C K Y F A Y S G D A G R D P S T Y P K A E L W Stop T K L F H F Stop C I N F L F V Stop Stop E N W E N D L Q Y A Y Q A V I P N I T Stop I H L Q R R Met F L V A I C T D G Met G P R D I S Stop R E G Stop G F E V Q L L S Q C Q K S Q G Q V R L S S L R P H P V E P H P R V G Q S T P R S R E G R S Q G W A Stop K S G Q S H L L L T F A S D T T V F T S N L K Q T P W C I Stop L L R R S L P L L P C G A R Stop T W Met K L V V R P W A G W Y Q G Y K T G L R R P I E T G H V E T E K T L G F L I G T D S L C L L V Y F P T L R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R V S L W D A Stop C F L S P S F L W L S S C H R K G I S N R V Q F R Met G N R R Met I A S V W K S Q D R F S F F Y L L F I T I V F F C L I L A F F F F L L R N F Y Y Y T Stop C L N I V Y N K R K Y L Stop D T L S N L K K N F T Q S A Stop Y I T I W N I C V L I C I F I I S L L Y F L L F L I D T Stop S L Y I F Met G Stop S V Met F Stop Y V Y T Y Stop P N Q G N F A F V I L K N A F F F Stop Y T F L F I L F L I L S L I S F F Q G N N D T Met Y H A S L H H S K E Stop Q Stop Stop F L G Stop G N S N I S A Y K Y F C I Stop I V T D V R G F I L L I A A T I Q L P F C F Y F Met V G I R L D Y S E S K L G P F A N H V H T S Y L P P T A P G Q R A G L C A G P S L W Q R I H P T S A G C L S E S G G W C G Stop C P G P Q V S L S S L S C C P I S I K G S F V P Stop V Q L L N W G I L Stop R A L S I W I L P N K K H L F S L Q Stop C I Stop I I S E Y F T K K G Met W


Sequencia 2:


5'3' Frame 3 I C F Stop H N C V H Stop Q P Q T D T Met V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H Stop A R F L A V Q F L L K V P L F P K S N Y Stop T G G Y Y E G P Stop A S G F C L I K N I Y F H C K K K K


Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)?


A sequência de E.coli é uma sequencia génica bacteriana como tal o seu transcrito será semelhante ao DNA genómico pois não existe grandes modificações entre DNA e mRNA, o processo não envolve processamento de RNA. No caso de eucariotas inferiores(levedura) a sequência de mRNA já manifesta maiores diferenças relativamente ao DNA respectivo uma vez que possui genes para o processamento havendo então remoção dos intrões. Contudo em qualquer um dos casos, o transcrito de mRNA é quase do mesmo tamanho do de DNA pois o splicing é inexistente ou muito pouco evidente(levedura).

As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração?


As proteínas humanas são codificadas por porções de DNA maiores e sofrem um splicing bastante mais expressivo podendo a sequência de mRNA conter um tamanho 10 vezes inferior à molécula de DNA original. Assim, a produção de proteínas humanas é um processo que envolve um cuidado muito maior e dispêndio de energia. As proteínas humanas têm uma sequência que é codificada apenas por exões sendo diferente do seu DNA(introes + exões). Desta forma, temos de proceder À conversão de mRNA proteico para DNA podendo então introduzir esta sequência no genoma bacteriano(sem intrões). Para que o DNA complementar 'humano' seja reconhecido pela bactéria e traduzido para proteina, ao nivel da transcrição, temos de introduzir uma molécula artificialmente no genoma bacteriano contendo um promotor bacteriano associado ao DNA humano e as UTRs devem ser também retiradas e substituídas por regiões reconhecidas pelas leveduras ou bactérias.