User:Gaston Paris:Notebook/Oligos

From OpenWetWare
Jump to: navigation, search

BamMET

5' GATGGATCCGATGGCAATAGATTTAAGGCCATTC 3' En negrita el sitio de restricción BamHI en fase con el el vector pTrcHisB y en itálica el ATG de inicio de la transcripción.

Este oligo amplifica el 5' de LOV de acuerdo a como está en el genoma de B. melitensis

Hind Stop

5' ATCAAGCTTCAGATGGAAAGCGTCTTGC 3' En negrita el sitio HindIII diseñado para clonar en pTrcHisB el gen LOV de B. melitensis y en itálica el stop de transcripción del gen LOV full.

STOPLOVHInd

5' ATCAAGCTTCACGCGATGCGCTGTTCCG 3' En negrita el sitio HindIII diseñado para clonar en pTrcHisB el gen LOV de B. melitensis y en itálica el stop de transcripción del dominio LOV.

5CheyFWD-BamHI

5' cgcggatccactggcgctttgtcgtgaa 3' Este oligo amplifica la región 5' del gen Chey (BAB1_0099) de B.abortus. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

5CheyREV

5' ggatgaagatcgttcatcaattttttctgct 3' Este oligo amplifica la región 5' del gen Chey (BAB1_0099) de B.abortus. En negrita la secuencia que aparea con el 3CheyFWD. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

3CheyFWD

5' gaacgatcttcatccagcgtcgcctgatg 3' Este oligo amplifica la región 3' del gen Chey (BAB1_0099) de B.abortus. En negrita la secuencia que aparea con el 5CheyREV. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

3CheyREV-SalI

5' cgcgtcgacgttcgcaccgcgcccgat 3' Este oligo amplifica la región 3' del gen Chey (BAB1_0099) de B.abortus. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

5Ba_0100FWD-BamHI

5' cgcggatcccatcaagccatcatgatatcgg 3' Este oligo amplifica la región 5' de un regulador transcripcional (BAB1_0100) de B.abortus. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

5BAB_0100REV

5' cgcggtaacgggtttcatgtcttttcctttcacg 3' Este oligo amplifica la región 5' de un regulador tranascripcional (BAB1_0100) de B.abortus. En negrita la secuencia que aparea con el 3BAB_0100FWD. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

3BAB_0100FWD

5' aaacccgttaccgcgttctgatttcaccgcgttc 3' Este oligo amplifica la región 3' de un regulador transcripcional (BAB1_0100) de B.abortus. En negrita la secuencia que aparea con el 5BAB_0100REV. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

3BAB_0100REV-SalI

5' cgcgtcgacttctggaaaaccggcatttc 3' Este oligo amplifica la región 3' de un regulador tranascripcional (BAB1_0100) de B.abortus. Se utiliza para realizar la mutante por deleción con el plásmido pK18mobSacB.

CheY_FWD_Nhe

5' cgcgctagcttgatgaacgatctcgaacatagg 3' En negrita el sitio NheI en fase con el pTrcHis y en itálica el ATG de inicio de la transcripción. Para clonar el ORF de CheY.

BAB1_0099_reverse

5' agactcgagtcaggcgacgctggatgaaaa 3' En negrita el sitio XhoI para clonar en pTrcHis el gen de CheY.

BAB_0100FWD_Nhe

5' cgcgctagcatgaaacccgttttcctgca 3' En negrita el sitio NheI en fase con el pTrcHis y en itálica el ATG de inicio de la transcripción. Para clonar el ORF de BAB1_0100.

BAB_0100REV_XhoI

5' cgcctcgagtcagaacgcggtgaaagtca 3' En negrita el sitio XhoI para clonar en pTrcHis el gen de BAB1_0100.

Brucella_FliM_ATG_Nde

5' ttacatatggatgacgccacaacgctg 3' En negrita el sitio NdeI para clonar en pET el gen FliM tanto de B. melitensis como B. abortus

Bmel_FliM_Stop_Bam

5' ttaggatccttagccagcaacaagctcatcga 3' En negrita el sitio BamHI para clonar en pET el gen FliM predicho en B. melitensis

Babo_FliM_Stop_Bam

5' ttaggattcttacctcctggcgaagcttttt 3' En negrita el sitio BamHI para clonar en pET el gen FliM predicho en B. abortus

1671_5_FWD_Eco

5' atagaattcCGGATCGTCTGTATTCCAGCCCCG 3' Para construir Δ1671 en B. abortus. En minúscula el fragmento agregado con el sitio EcoRI para clonar.

1671_5_REV

5' CAGCAACTAACGTCATGATTCAGGGACTC 3' Para construir Δ1671 en B. abortus

1671_3_FWD

5' TGACGTTAGTTGCTGCCTGACGCTGGCAGGC 3' Para construir Δ1671 en B. abortus

1671_3_REV_Eco

5' atagaattcttgccgaggcgatgagcgaaat 3' Para construir Δ1671 en B. abortus. En negrita el sitio EcoRI para ligar en el vector.

BaLOVHK_5_FWD_Bam

5' ataggatccTTAACCCCATTATTATGCGGGC 3' Para construir ΔLOV en B. abortus. En negrita el sitio BamHI para ligar en el vector.

BaLOVHK_5_REV

5' CCTCCGGTGAAGAAAGCGGCAATTGCG 3' Para construir ΔLOV en B. abortus.

BaLOVHK_3_FWD

5' TTCTTCACCGGAGGTTATGCAACCG 3' Para construir ΔLOV en B. abortus.

BaLOVHK_3_REV_Bam

5' ataggatccGTCAACCCTTCGGCGATGAGC 3' Para construir ΔLOV en B. abortus. En negrita el sitio BamHI para ligar en el vector.

Rle_Flank5_RR5_NotI_FWD

5' ataGCGGCCGCTCCGGAGAGAGTGTCGCT 3' Para construir mutante RR5 en Rhizobium. En negrita sitio NotI.

Rle_Flank5_RR5_REV

5' GGATCCGGGGAATTCCTTCGACGATGAATATGTCT 3' Para construir mutante RR5 en Rhizobium.

Rle_Flank3_RR5_FWD

5' GGATCCGGGGAATTCACGACGCGCTGATTGCCATG 3' Para construir mutante RR5 en Rhizobium.

Rle_Flank3_RR5_XhoI_REV

5' ataCTCGAGCAGACGATCTTGATCTGCCG 3' Para construir mutante RR5 en Rhizobium. En negrita sitio XhoI.

Rle_Flank5_RR2_NotI_FWD

5' ataGCGGCCGCTTTCCACGAGCCGGG 3' Para construir mutante RR2 en Rhizobium. En negrita sitio NotI.

Rle_Flank5_RR2_REV

5' AATCACCGGATCCCCGTCGACATAAAATAGGGTGGT 3' Para construir mutante RR2 en Rhizobium.

Rle_Flank3_RR2_FWD

5' AATCACCGGATCCCCGACAGCAAGGATGACCTCT 3' Para construir mutante RR2 en Rhizobium.

Rle_Flank3_RR2_XhoI_REV

5' ataCTCGAGATTGCCGGGGCATTG 3' Para construir mutante RR2 en Rhizobium. En negrita sitio XhoI.