User:Gabrielle A. Kean/Notebook/Biology 210 at AU
03/19/2015 Zebrafish Development in Conjunction with Retinoic Acid
Purpose: To observe and compare embryonic development in zebrafish that have and have not been exposed to retinoic acid.
Introduction: The development of all organisms is an extremely crucial part of life (Bentley., et al. 2015). An organism's life is influenced greatly on its development, for it determines its way of life and ultimately survival. Several factors and elements can disturb and ultimately harm or inhibit embryonic development, such as caffeine, alcohol, or retinoic acid. In high functioning mammals of the chordate phylum and higher a metabolite of Vitamin A--retoinoic acid--can have detrimental effects on embryonic development (Herrmann). Such effects include birth defects or halt of pregnancy outright (Herrmann). Embryonic development in under retinoic acid conditions can be studied in various organisms, but zebrafish prove to be the prime subjects. Because zebrafish develop rapidly, in large numbers, and their embryos are translucent, observing development is very easy and proves efficient (Herrmann). When exposed to high amount of retinoic acid, zebrafish delay in hating, develop a short or crooked tail, ill formed or unformed valves on the heart and brain, and the absence of one or both eyes (Hermann).
Materials and Methods: Two separate dishes were filled with 20 zebrafish eggs. One dish was the control group where 20mL of water was injected and the other was the test group where 20 mL of retinoic acid was injected. Once the eggs hatched on day 4 10 mLs of water was removed along with empty egg cases and 25 mLs of fresh water was added to the control group and 25 mL of retinoic acid to the test group. The fish were feed paramecium provided by the biology department every couple of days. Every week the degree of body and tail pigmentation, heart and heart rate, pectoral fin development, mouth, and general moment were observed.
Results:
(2/20): This was the fourth day after placement of the zebrafish embryos. There were no hatching in either dishes. In the test group there were three dead embryos. In the control group there was only one dead embryo.
(2/23): Most of the fish hatched. Three additional fish died in the test group totaling 16 fish left in the entire dish. One additional fish died in the control group totaling 18 fish left.
(2/26): Three more fish died in the test group. One more fish died in the control group. Fish in both test and variable groups are very active. Fish in test group are more lethargic and reflexes are less poignant than those in the control group. Test group movement is also more sporadic and chopped rather than smooth. On a rating scale from 1-5 that my lab partner and my self created, movement for test group was a 2 while movement for control group was a 5.
(3/6): All fish in test group died. Six fish are dead in control group. Within the test group, only nine reached full development and their pigment was cloudy and dark blue. Nine fish are alive in the control group with a movement of 5. The nine fish are 5 cm in length-- larger than the fish in the test group.
Conclusions: The fish in the control group are more attentive, structured, and healthy. There is a clear development of organs and structure which can be observed an a dissecting microscope. On a compound microscope at 4x the fish are 15.5-17 mm. There is no front fin development observed and minimal development of the dorsal fin. The eye is 5x5.5 and there the pupil is transparent. The fixed fish on day 7 of the retinoic acid is 14 mm on 4x and has a grey pigment. Both back and side fins are starting to develop. Eye measures 5x5.5 with no pupil. Between both groups, all the embryos hatched normally in a 6 day span. There were a higher number of fish that hatched in the control group than in the test group. The effects of retinoic acid can be clearly seen in the test group of zebrafish embryos. Organ development is disrupted in the test group and the heart and brain are misplaced compared to those in the control group. Due to the higher mortality rate and morbidity rate of zebrafish exposed to retinoic acid than those exposed to only water, retinoic acid is indeed detrimental to embryonic development.
Bentley, Meg; Laslo, Mara; Walter-Conte, Kathryn, and Zeller, Nancy K. A. 2015. Laboratory Manual to Accompany General Biology II p. 51 -54
Herrmann, K., 1995. “Teratogenic Effects of Retinoic Acid and Related Substances on the Early Development of Zebrafish as Assessed by a Novel Scoring System”
GK
03/05/2015 Identifying Bacteria
Purpose: The purpose of this lab is to identify bacteria form Transect 3 that was grown on the agar plates with and without Tetracycline.
Materials and Methods: A 16S PCR Sequence was used to identify species of bacteria. Bacteria was identified and classified using BLAST software.
Results:
Image 1: Gel Electrophoresis
PCR reaction is in row 2.
The Raw Data from the PCR 16S is as follows:
NNNNNNNNNGNNTNNAATGCANNCGANANGGAGCANNANTTGTCTGGGGGAGNGCGACGGGNGAGTNTATATCGGAACGT ACCCTANGTGGGGGATATCGTCTCGAAAGTTACGCTAATACCGCATACGATCTAAGGTGAAAGCGGGGGATCGCAAGACC TCGCGCTCGTGGAGCGGCCGATATCTGATTATATAGTTGGTANGATAAAAGCCTACCAAGGCGTCGATCTGTAGCTGGTC TGAGAGGACGACCAGCCACACTGGGACTGAGACACGGNCNAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGNACAAT GGGCGAAAGCCTGATCCANCAATGCCGCGTGNNNNNAGAAGGCCTTCGGGTTGTAAANCTCTTTTNTNNGGCNANGANAA GGNNGANAGCTAATANCCCNNTGGTTNTTGACGNTACCTNNAGAATAAGCACCGGCTNNNNTACTNTGNNANCAGCCGCG GATAATACNNNAGGNGTGCTNANNNGNNTNNTNNGGNNATNNANNTGNNGNNGTNANNNNNNNNGCCGCNNNGNNNGGGG TNTNNNTGNTNNANNANCNNNNANNNNNANNNNNNNNNCTNGNNCNTNNNNNCNNNTGGNGTGNNNNNNNNCNNNTNNNN NNNNNANNNNNNNNNNNNNNTANNNNNNTNANNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNTNTNNNNNNNNNNNNN NNNNNNNNNNGNNNNNAANNNNNTNNNCNNGTNAGTNNNNNNNNGGGNNNGGNNNNNNNNNCNNNNNCTGGNNNGNNNNN NNNNCNNNGNNNNNNNNNNNNNNNNNNNNNNNANCNNANNNNNNNNNNNNNNNNNN
Conclusion: According to the BLAST software, the highest match was Uncultured Oxalobacteraceae bacterium. Oxalobacteraceae is a gram negative bacteria that has a morphology similar to the bacteria from the agar plates. It is dark purple, wrinkled, raised, with an undulated edge. Oxalobacteraceae aids in nitrogen fixation as well as producing energy (anaerobes and aerobes).
GK
02/12/2015 Vertebrates and Niches
Purpose: As the final part of the study of Transect 3, the purpose of this lab is to consider the vertebrates that inhabit and/or pass through the transect. This includes studying the actual animals as well as determining which animals may have passed through by observing other abiotic things. Identifying the vertebrates within a transect can help understand the purpose each organisms plays within an ecosystem and the roles each organisms plays in relation to one another.
Materials and Methods: The transect was observed mid morning on a cold February morning where the temperature ranged from 25-32 degrees Fahrenheit. The transect was observed for about 20 minutes.
Data and Observations: There were five vertebrates observed and classified.
1. Eastern Gray Squirrel (Phylum Chordata, Class Mammalia, Order Rodenta, Family Sciuridae, Genus Sciurus, Species Arolinesis)
2. Rat (Phylum Chordata, Class Mammalia, Order Rodenta, Family Muridae, Species, Norvegicus)
3. Eastern Fox Squirrel (Phylum Chordata, Class Mammalia, Order Rodenta, Family Sciuridae, Genus sciurus, Species Niger)
4. Bald Eagle (Phylum Chordata, Class Aves, Order Accipiritformes, Family Accipitridae, Genus Haliaeetus, Species Leucocephalus
5. Song Sparrow (Phylum Chordata, Class Aves, Order Passeriformes, Family Emberizidae, Genus Melospiza, Species Melodia
Transect 3 Food Chain
This is a representation of the food chain of the vertebrates and invertebrates found in Transect 3. At the top of the food chain is the bald eagle which preys on other animals. The second level of the food chain are the vertebrates who feed on trees and shrub as well as the arthropods found within the transect. The third level are the invertebrates found within the soil and on leaves in transect 3 which thus feed on bacteria found within the transect. The final level of the food chain contains the bacteria and that invertebrates feed on.
Conclusion and Further Directions: Each organisms within this Transect plays a crucial role in creating a sustaining ecosystem. Each vertebrate, invertebrate, and bacteria form either a symbiotic or parasitic, or mutualistic relationship. The bacteria provide food for the invertebrates, the invertebrates are a food source for the vertebrates, and smaller animals are a food source for larger animals. Other abiotic components than benefit the organisms within the transect are shrubs, trees, and branches that provide shelter and a food source for these organisms. Soil is a food source as well as shelter for bacteria and a shelter for invertebrates and vertebarates such as birds who build nests using branches and leaves. The relationship between each organisms and abiotic components represents the ecological concepts of community, carrying capacity, an trophic levels. Trophic levels refers to an organisms food source and whether they are another organisms food source, carrying capacity refers to the number of organisms living within the ecosystem which all comes together to form a community the ecosystem in which these organisms resides and the relationships between one another.
GK
05/12/2015 Transect 3's Invertebrates
Purpose: The purpose of this lab is to observe and understand invertebrates from Transect 3 that were extracted using a Burlese Funnel. The observation of these invertebrates will aid in understanding the importance of invertebrates and how they are a crucial part of an entire ecosystem. Another aim of this lab is to track the evolution of complex systems from simple inveterate systems.
Materials and Methods: Three Arthropods--Acoelomates, Pseudocoelomates, and Coelomates--were observed with a dissecting scope. The movement, digestive tract, and mesoderm of these Arthropods were observed. A whole mount of Planaria, an Acoelomate, was used to observe the digestive tract. Cross sectionals slides were also used to observe the movement of nematodes and the coelomate Annedlida. Organisms from the classes arachnida, diplopoda, chilopoda, insect, and crustacea were observed and each body part, segment, and the number of appendages were noted. For the purpose of this lab, the Berlese Funnel was broken down and the top 10-15 mLs of liquid and organisms were poured into one petri dish. The remaining liquid was poured into a second dish and both dishes were examined under a dissecting microscope. The invertebrates found under the dissecting microscope were identified using a dichotomous key after careful examination. Specifically Transect 3, another group's Transect 3 in a different lab section, petri dishes were used.
Data and Observations:
Table 1: Invertebrates Found in Transect 3
Photo 1: Biting Lice from Transect 3
Error creating thumbnail: File missing
Photo 2: Pill Bug Found in Transect 3
Error creating thumbnail: File missing
Figure 1: Common Soil Invertebrates
Conclusion and Further Directions: After observing Planaria the organisms movement is symmetrical compared to nematodes whose movement is sporadic and wiggly moving one direction at a time like its small and slender body structure. Annelida's organs are not set i place allowing it to move freely in all directions. Five different inverteberates were found that were part of the Arthopoda insecta phylum and class. These organisms different in appendages and body structure. The smallest invertebrate was the sucking lice at .5 mm and the largest inveterate was the pill bug at 12 mm. The most common invertebrate was the biting lice where three samples were found in the leaf litter. The differences in each organisms is a vital part of each ecosystem.
GK
02/05/2015 Identifying and Studying Transect 3's Plante and Fungi
Purpose: The purpose of this lab was to identify the characteristics of five plants and some fungi found in Transect 3. Observing such characteristics that include, vascularization, size, and mechanisms of reproduction can help understand the vast diversity of the Plantae kingdom. Observing fungi can also help understand its function and importance in an ecosystem.
Materials and Methods: For the purpose of next week's lab a leaf litter sample that contained soil and dead leaves were collected for the Berlese funnel for collected inverteberates. The Berlese Funnel was created by pouring 25 mL of 50:50 ethanol/water solution into a 50 ML conical tube. Screening material was put into the bottom of the funnel and taped to secure the leaf litter. The Leaf litter sample was placed in the top funnel and set up on a string stand to hold the tube and ethanol in place. A lighted 40 watt lamp was placed above the funnel about 1-2 inches from the top of the leaf littered. The entire Berlese funnel was covered in funnel and left alone. For the purpose of this week's lab five plant samples were taken from Transect 3. These samples included branches and leaves from bushes, trees, and flowers. The five plants samples were spliced and observed under a microscope where their vascularization, specialized structures, size, shape, and methods of reproduction were identified. A ruler was also used to measure the plant samples length in mm before splicing. Transect 3 did not contain any fungi and therefore observed samples already prepared. The PCR from the previous lab was placed in agarose gel wells and placed under a UV light to for further observation.
Data and Observations:
Table 1: Transect 3 Plant Observations
Photo 1: Plant Sample 2 Vascular System
Error creating thumbnail: File missing
Photo 2: Plant Sample 3 Vascular System
Error creating thumbnail: File missing
Photo 3: Plant Sample 4 Vascular System
Error creating thumbnail: File missing
Photo 4: Plant Sample 5 Vascular System
Error creating thumbnail: File missing
Photo 5: Rhizopus strolonifer ''
Error creating thumbnail: File missing
Conclusion and Further Directions: Transect 3 is composed of a wide variety of plant life, but little to no fungi was found. Transect 3 is composed of trees, flowers, and bushes that are angiosperms, dicots, monocots, and of all shapes and sizes. Some plant leaves are large, such as the ground plant and possible tulip flower leaf that was 8.9 mm. Others are short such as the bush leaf at 4.3 mm. The PCR sample worked best with agar plates 2 and 4 from 10^-6 without Tetracycline. Next week we will observe and identify invertebrates found within the leaf litter from Transect 3.
GK
01/29/2015 Identifying Transect 3's Bacteria with DNA Sequences
Purpose: The purpose of this lab was to identify and observe growth of bacteria on agar plates from Transect 3's Hay Infusion. The growth of these unicellular organisms was observed to understand their characteristics which include, shape, cell wall structure, whether they are antibiotic-resistant, and DNA differences between species. Although unicellular organisms are found within all three domain's of life, unicellular Archaea will have grown on the agar plates, because they are found in extreme environments.
Materials and Methods: Before the lab procedure, Transect 3's Hay Infusion was observed one last time. For the purpose of the lab the bacteria growth on the eight--4 with Tetracycline and 4 without--agar plates from the Hay Infusion culture was observed, and the total number of bacteria colonies on each plate were counted. Bacteria was taken from 3 agar plates with the antibiotic Tetracycline and 1 agar plate without Tetracycline. From these agar plates four wet mount slides were created to observe the unicellular bacteria under a microscope. In order to create a wet mount slide a loop was sterilized over a flame before taking a small amount of bacteria from the agar. The bacteria from the agar plates and water were mixed together on a slide. Under the microscope the wet mount was observed using the 10x and 40x objective. A gram stain was conducted by creating four more wet mounts of bacteria--3 from agar plates without Tetracycline and 1 from an agar plate with Tetracycline. The wet mount slides were passed over a false to air dry the bacterial smear. In order to stain the bacteria, the bacterial smear was covered with crystal violet for 1 minute and rinsed off and covered with Gram iodine mordant for 1 minute and then rinsed off. The bacterial smear was decolonized with 95% alcohol for 10-20 seconds and rinsed off. The smear was covered with a safranin stain for 20-30 seconds and raised off with water. The newly gram-stained bacteria wet mount slide was focused at a 10x, 40x, and 100x objective under the microscope. In preparation for next week's lab, to determine DNA sequences of bacteria, a single colony of bacteria was transferred to 100 microliters of water in a sterile tube. The sterile tube was incubated in a heat block at 100 Celsius for 10 minutes and centrifuged for 5 minutes at 13,400 rmp. 20 miroliters of water and primer were mixed and dissolved in a PCR Tube with a PCR bead. 5 micrometers of supernatant from the centrifuged samples was transferred to the 16S PCR reaction and placed in the PCR machine.
Data and Observations:
Table 1: 100-fold Serial Dilutions Results
Photo 1: Colony 1 without Tetracycline
Error creating thumbnail: File missing
Photo 2: Colony 2 without Tetracycline
Error creating thumbnail: File missing
Photo 3: Colony 3 Without Tetracycline
Error creating thumbnail: File missing
Photo 4: Colony 4 Without Tetracycline
Error creating thumbnail: File missing
Photo 5: Gram Stain of Colony 2 without Tetracycline
Error creating thumbnail: File missing
Photo 6: Gram Stain of Colony 3 without Tetracycline
Error creating thumbnail: File missing
Photo 7: Gram Stain of Colony 4 with Tetracycline
Error creating thumbnail: File missing
Table 2: Bacteria and Characterization
Conclusions and Further Directions: We can conclude the antibiotic Tetracycline kills most bacteria, but not all for there are bacteria that are antibiotic resistant. The bacterial colonies on the agar plates without Tetracycline varies in size and shape of colonies and shades of purple and orange colors. The agar plates with Tetracycline had less growth and less variation in color and size and shape, for all the bacteria were orange and round. The orange bacteria may have been the only bacteria to thrive in a Tetracycline environment for all the other purple bacteria died. Tetracycline kills bacteria by inhibiting protein synthesis and preventing the attachment of aminoacyl-tRNA to the ribosomal acceptor. Bacteria that are killed by Tetracycline include E.coli, TB, a strain of the flu, and pseudonomonas aeruginosa. For the purpose of our lab and to determine what bacteria Tetracycline specifically killed we will look at bacteria's DNA in an agarose gel from a PCR product.
Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, US National Library of Medicine 65(2), 232–260.
GK
01/22/2015 Observing and Identifying Unicellular Eukarya in Transect 3
Purpose: The purpose of this lab was to observe and identify any unicellular eukaryotic organisms, such as protists or algae in Transect 3. Identifying which organisms are present can then determine the carrying capacities in each particular niche.
Materials and Methods: For the purpose of this lab two wet mounts were made with samples from two different parts of the 500 mL Hay Infusion. The first wet mount was drawn from life onto of the Hay Infusion, while the second wet mount was drawn from the bottom of the Hay Infusion. A microscope was used to observe organisms on both wet mounts and a dichotomous key was used to identify the organisms.
Data and Observations: The Hay Infusion smelt murky, like a stagnant water or still pond. A murky brown film, possibly composed of mold, sat on top. The bottom of the Hay Infusion was more translucent with scattered brown clumps, the berry that was collected, and some plant life.
Table 1: Unicellular Eukarya Organisms found in the Hay Infusion
Conclusions and Future Directions: Each niche provides a necessary function and for each organism based on its carrying capacity. Bursar truncatella, gonium, and pelomyxa are found closer to the surface where perhaps there is more oxygen present and mold growing. Colpidium, Belpdarisma, and Chlamydomas, are found closer to plant life. In future, if the Hay Infusion were to observed over a longer period of time, I would expect more unicellular eukaryotes to grow as the ones present reproduce.
GK
01/15/2015 Transect 3 and its Components
Purpose: The purpose of this lab was to observe a transect and the ecosystem that composes it. Observing this transect is very important in for it provides understanding of the intricate relationships between each biotic and abiotic component along with the niche it inhabits.
Materials and Methods: For the purpose of this lab, a 20 by 20 meter transect was observed. 12 grams of soil and 1 berry from the transect was collected with the use of a sterile 50 mL conical tube. The 12 grams of soil was mixed with 500 mLs of deepark water and .1 gm of dried milk was added and mixed for 10 seconds.
Data and Observations:
Table 1: Abiotic and Biotic Components of Transect 3
File:Users/gabriellekean/Desktop/Screen Shot 2015-01-25 at 10.57.02 PM.png.jpg
This list of Abiotic and Biotic Components were taken from transect 3 located between Bender Arena and Hughes Hall at American University.
Image 1: Drawing of Transect Error creating thumbnail: File missing
Conclusions and Future Directions: Transect 3 was composed of multifarious components, both biotic and abiotic. These components come together to make the ecosystem between Bender Arena and Hughes Hall. Future experiments will be conducted to identify the organisms living in the transect in order to more understand the specifics of this ecosystem.
GK
01/21/2015
I am a Public Health major with an intended minor in business administration.
GK
01/25/2015 Tranethods: For the purpose of this lab, a 20 by 20 meter transect was observed. 12 grams of soil and 1 berry from the transect was collected with the use of a sterile 50 mL conical tube. The 12 grams of soil was mixed with 500 mLs of deepark water and .1 gm of dried milk was added and mixed for 10 seconds.
Data and Observations:
Table 1: Abiotic and Biotic Components of Transect 3
File:Users/gabriellekean/Desktop/Screen Shot 2015-01-25 at 10.57.02 PM.png.jpg
This list of Abiotic and Biotic Components were taken from transect 3 located between Bender Arena and Hughes Hall at American University.
Image 1: Drawing of Transect Error creating thumbnail: File missing
Conclusions and Future Directions: Transect 3 was composed of multifarious components, both biotic and abiotic. These components come together to make the ecosystem between Bender Arena and Hughes Hall. Future experiments will be conducted to identify the organisms living in the transect in order to more understand the specifics of this ecosystem.
GK








