User:Esther Lee/Notebook/DNA Sequencing/Entry Base

Project name

Main project page

DNA SEQUENCING Objective: To identify through DNA sequencing, the microorganism in found in the transects. Result of gel electrophoresis We were not able to get valid results for DNA sequencing for our transect. However, we were able to observe Transect 3: Tall Grass because of the similarities of two transects. The DNA Sequence was: AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGG GGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT Using NCBI BLAST, we identified the specie as Chryseobacterium and can be assumed that this particular bacteria is found in both tall grass and wildlife transects.