User:Eric M. Walters/Notebook/Spring 2012/2012/02/06

From OpenWetWare
Jump to navigationJump to search
Project name Main project page
Next entry

On trying to amplify acsA-up+accBCDA+acsA-dn off of a ligation

  • Been trying to do this for a week
  • Latest problem: ligation appears to have correct size band (5.5kb), but amplification doesn't work
    • Will do Phusion temperature gradient, since 5.5kb template may act differently than .5kb
    • FTR the primers (acsA-UF, acsA-DR) should have the same melting temperature
      • acsA-UF: GATTTTCAAGCCCAGGTGACTG
      • acsA-DR: CTATATCTGGCAAACAACTTTGGC


Temp Time
95 2:00
95 :30
47-63 :30
72 1:40
Repeat 35x
72 4:00
4 Hold
Reagent In ea (25ul) M. mix
Phusion 0.5 4.5
dNTP 0.5 4.5
acsA-UF 0.5 4.5
acsA-DR 0.5 4.5
Ligation 0.5 4.5
HF buffer 5 45
Water 17.5 157.5


Sidebar: WTF ladder??

  • Ran 2 gels last week where the ladder looked like hell
  • Maybe got left out? Nucleases got in?
  • Running all ladders (2 & 4 ul 2-log) in iGEM lab out on 1% agarose gel, 90V 30 min
  • RESULT: Ladders looked okay (and compared to Matt's upstairs)
    • Some loss of definition of closer lines
    • Previous issues must have arisen from autofocus seeing so much DNA in extraction lanes?