User:Catherine Koenigsknecht/Notebook/Experimental Biological Chemistry/2011/11/01

Error creating thumbnail: Unable to save thumbnail to destination Biomaterials Design Lab

Main project page Previous entry      Next entry

Entry title Objective Synthesize Au nanoparticles using alternative method. Description 15.5 uM stock solution BSA 2.9 mM solution HAuCl Make up four test tubes: 1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous) 2. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (take out of oven) 3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous) 4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven) Run PCR Data Tube 1 had a clump of black (with a purplish tint) fibers. Tube 2 had more purplish fibers that were not clumped as much. Tubes 3&4 remained clear. Notes Place in oven at 12:51; take out 2 and 4 at 1:21 Use Primers: DIC GFPcorr r(GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA); DIC GFPcorr f(TACgacgatgacgataagtgtcgatggggatccgaattc)