User:Catherine Koenigsknecht/Notebook/Experimental Biological Chemistry/2011/11/01

From OpenWetWare
Jump to navigationJump to search
BDLlogo notext lr.png Biomaterials Design Lab Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Entry title

Objective

Synthesize Au nanoparticles using alternative method.

Description

  1. 15.5 uM stock solution BSA 2.9 mM solution HAuCl
  2. Make up four test tubes:
  • 1. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 2. 1 mL BSA 1 mL AU 8 mL 3.6 pH Buffer solution (take out of oven)
  • 3. 1 mL BSA 1 mL HCl 8 mL 3.6 pH Buffer solution (place in oven continuous)
  • 4. 1 mL BSA 1 ml HCl 8 mL 3.6 pH Buffer solution (take out of oven)
  1. Run PCR

Data

  • Tube 1 had a clump of black (with a purplish tint) fibers.
  • Tube 2 had more purplish fibers that were not clumped as much.
  • Tubes 3&4 remained clear.

Notes

Place in oven at 12:51; take out 2 and 4 at 1:21

  • Use Primers: DIC GFPcorr r(GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA); DIC GFPcorr f(TACgacgatgacgataagtgtcgatggggatccgaattc)