User:Brett Dempsey/Notebook/Biology 210 at AU
March 22, 2014
Introduction
It is very important to study the effects of different substances on animal embryos in order to determine their effect on humans. Similarly to the study performed by Yau-Hung Chen and her team, “Movement Disorder and Neuromuscular Change in Zebrafish Embryos After Exposure to Caffeine”, the effect of caffeine on zebrafish embryos was studied. In today’s day and age, caffeine is gaining popularity very quickly. Because of this, it’s important to determine this substance’s effect on human embryos. Zebrafish are a great model organism to study for this, since they develop quickly and their development is easily observed. The objective of this experiment was to determine the behavioral and physical effects of caffeine on zebrafish embryo development.
Materials and Methods
1. Using a transfer pipet, put 20 zebrafish embryos in a petri dish with 25 mL of water and a petri dish with 25 mL of a caffeine solution
2. Collect data on the pre-determine dependent variables every three days.
3. Continue to collect data and make observations for about 2 and a half weeks
4. Observe the following dependent variables: Amount hatched, amount dead and alive, movement of swimming, amount of yolk, development of pigmentation and movement, morphology of body and tail, heart rate per min, observations of fins, and swimmer blades, tail length, total length, and eye diameter Change the water and caffeine solution every day data is taken by replacing 10 mL of each
5. Get rid of dead zebrafish
6. Preserve the dead zebrafish that have something of interest about them
Results
Table 1: Dependent Variable Data
In the end, the caffeine killed all of the embryos. However, there wasn’t really a treatment effect observed because there was only two control embryos left. By the tenth day, the treatment group looked much skinnier and showed less movement than the control group though.
Conclusions and Future Plans
On the days where the body and tail were not measured, it was because it was impossible to get a sample for measuring. It was very interesting that the heart rate observed was higher in the treatment group than in the control group. This goes along with what we know about caffeine's effect on humans. The caffeine treatment definitely was a detriment to the embryonic development. The zebrafish that were treated with caffeine looked very emaciated and malnourished. This definitely was an impact of the caffeine. This has implications for humans; if the same thing happens with human embryos, then pregnant women should probably avoid the use of caffein products in order to ensure proper development of their baby. Future research could be to test the effects of caffeine on babies of species that are more closely related to humans. Also, another experiment could be conducted where there is better living conditions for the embryos. This would ensure that the environmental conditions didn't play a role, just the caffeine. The objective of determining the behavioral and physical effects of caffeine on zebrafish embryo development was met by this experiment.
BD
March 12, 2014
Introduction
The objectives of this experiment are to understand how DNA sequences are used to identify species and to understand how to use a Nucleotide Blast to gather information about a species. We will accomplish this by analyzing DNA sequences obtained from a PCR reaction with a nucleotide blast.
Materials and Methods
PCR Preparation for DNA Sequence Identification
1. Select a bacteria from the nutrient agar plates and one from the tetracycline plates
2. Transfer a single colony of bacteria to 100 microliters of water in a sterile tube
3. Incubate at 100 degrees Celcius for 10 minutes and centrifuge
4. Use 5 microliters of supernatant in the PCR reaction
5. Run the PCR products on an agarose gel
6. Purify the PCR products using a Qiagen kit and send PCR products to Genewiz Inc. for sequencing
Raw Data
DNA Sequence from the Nutrient Agar Plate (A6-T2-1):
TCNGCTACTCTCACGAGAGTAGGTTTATCCCTGTACAAAAGAAGTTTACAACCCATAGGGCCGTCGTCCTTCACGCGGGATGGCTGGATCAGGCTCTCACCCATTGTCCAATATTCCTCACTGCTGCCTCCCGTAGGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGATCACCCTCTCAGGCCCCCTAAAGATCACTGACTTGGTAGGCCGTTACCCTACCAACTATCTAATCTTGCGCGTGCCCATCTCTATCCACCGGAGTTTTCAATAATAAATGATGCCATTCATTATATTATGGGGTATTAATCTTCCTTTCGAAAGGCTATCCCCCTGATAAAGGCAGGTTGCACACGTGTTCCGCACCCGTACGCCGCTCTCAAGATTCCGAAGAATCTCTACCGCTCG
DNA Sequence from the Tetracycline Plate (A6-T2-2)
GCNAGTCGANCGGCAGCGCGGGAGCAATCCTGGCGGCGAGTGGCGAACGGGTGAGTAATACATCGGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATGAAAGCAGGGGATCGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAAGCCTTCGATCTGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGGAACGAAACGGCCTTTTCTAATAAAG
Conclusions and Future Plans
When the second DNA sequence was blasted, it was identified to be Variovorax sp. NW-2013-Rh12. Its full lineage is Bacteria, proteobacteria, betaproteobacteria, burkholderiales, comamonadaceae, and variovorax. This particular bacterium had the highest score of 747, and the highest query cover of 99%. According to GenBank, this is a bacteria associated with yellow lupin grown on a metal-contaminated soil. This leads to the conclusion that the transect (transect 2) has metal contamination in the soil. The objectives of understanding how DNA sequences are used to identify species and to understanding how to use a Nucleotide Blast to gather information about a species were met by this experiment.
BD
February 25, 2014
Introduction
The objectives of this experiment are to understand the importance of invertebrates and to learn how simple systems evolved into more complex systems. We will accomplish this by observing known invertebrates, analyzing the invertebrates collected in the Berlese funnel, and study vertebrates and their respective niches.
Materials and Methods
Analyzing Acoelomates, Pseudocoelomates, and Coelomates Procedure 1. Observe the pre-prepared slides and organisms 2. Note the different types of movement and sizes in the organisms
Analyzing the Invertebrates Collected with the Berlese Funnel Procedure 1. Break down the Berlese setup and transfer the preservation system to a Petri dish 2. Randomly select five organisms in the petri dish and idenfiy them 3. Describe the distinguishing characteristics of these organisms
Raw Data
Table 1: Berlese Funnel Organisms
https://docs.google.com/document/d/1ffzHwzr26CmNjoWQ1qmG-8XGejMvm7R9k58Z068_arI/edit?usp=sharing
The size range of organisms measured was 1 mm to 4 mm. The Lepidoptera and Coleoptera were the largest, while the the Flea and Soil Mite were the smallest. The soil mites were the most common in the leaf litter.
Table 2: Arthropods Worksheet Results
https://docs.google.com/document/d/1Z8wtoOyrBilUGpQ0TsXKiv1Uozw_GEtQcfd5kDdRiSw/edit?usp=sharing
Table 3: Organisms that Might Inhabit the Transect
https://docs.google.com/document/d/1gwg2TTVZhA4X81Yvxbx4KYK8SPcwhd9K8Z1XEw29Yes/edit?usp=sharing
Figure 1: Transect Food Web
https://docs.google.com/document/d/1D-bSOcbt5JJ6TvpXP48qhHwasiFwwNjwvpYqhavKEjs/edit?usp=sharing
Conclusions and Future Plans
The samples obtained from the transect were not very surprising. Spiders, fleas, and soil mites are pretty standard invertebrates for an area like our transect. Future studies could be to monitor the transect for a longer period of time and see if any new types of invertebrates show up in berlese funnel collections. The objectives of understanding the importance of invertebrates and learning how simple systems evolved into more complex systems were met.
BD
February 25, 2014
Introduction
The objectives of this experiment are to understand the characteristics and diversity of Plants and to appreciate the function and importance of Fungi. We will accomplish these objectives by collecting and observing plant samples from the transect, viewing known samples of plants to identify vascularization, reproduction, and specialization, and viewing known samples of fungi.
Materials and Methods
Collecting Samples from the Transect Procedure
1. Bring three bags to the transect
2. Obtain a leaf litter sample of about 500 g and place it into a bag
3. Take representative samples from five plants in a minimally damaging way
4. Bring back seeds, pine cones, flowers
Plant Vascularization Procedure
1. Briefly describe the vascularization in each of the plants from the transect
Plant Specialization Procedure
1. Briefly describe the shape, size, and cluster arrangement of the leaves from the transect plants
Plant Reproduction Procedure
1. Identify the seeds that were brought back from transect as either monocot or dicot
2. See if there is any evidence of flowers or spores
Observing Fungi Procedure
1. Look at some of the samples under the microscope and determine which are fungi and which of the three groups they belong to
2. Draw a picture of the ones that are identified as fungi
Raw Data
Table 1: Transect Plants (#1-5)
https://docs.google.com/document/d/1JUMULvxn5mqF4jMWLrN_BQitIl0dEEflXY5g_viKmZ8/edit?usp=sharing
Figure 1: Pictures of Samples from Transect
https://docs.google.com/document/d/1p1gIQMk_2M3XZz0dXXbV70cjWLr8i2V4RsjYHnVmuY4/edit?usp=sharing
Figure 2: Transect Diagram with Sample Locations
https://docs.google.com/document/d/1gor8pju2RX8R5Upce2tPXO2pHT4iDw4sl65hNVBVM-s/edit?usp=sharing
Figure 3: Drawing of Fungus
https://docs.google.com/document/d/1gPkcisp9B3UJCbePwgUdgrtWpCksTOPM1Kix1uzj6eg/edit?usp=sharing
This fungus was determined to be fungi sporangia, part of the zygomycota group. It was determined to be a fungus mainly because of its easily identifiable sporangia.
Conclusions and Future Plans
The samples obtained from the transect were not very surprising. These plants are pretty common in this area of the country. Future studies could be to monitor the transect for a longer period of time and see if any new plant species starts to grow there. The objectives of understanding the characteristics and diversity of Plants and to appreciate the function and importance of Fungi were met by this experiment.
BD
February 14, 2014
Introduction
The objectives of this experiment are to understand the characteristics of bacteria, to observe antibiotic resistance, and to understand how DNA sequences are used to identify species. We will accomplish these objectives by observing known samples and bacteria found in agar plates from the hay infusion cultures. It was hypothesized that no Archaea species will have grown on the agar plates since they are not really extreme conditions like Archaea are usually found in.
Materials and Methods
Quantifying and Observing Microorganisms Procedure
1. View the colonies that have formed on the agar plates 2. Count the number of colonies of bacteria on each plate
Bacteria Cell Morphology Observations Procedure
1. Observe prepared slides of bacteria using the 100x oil immersion objective lens 2. Obtain two samples from the nutrient agar plate and two samples from the nutrient agar plus tetracycline plate 3. Make a wet mount of the samples 4. Observe the wet mounts under 10x and then 40x 5. Gram stain the four samples using the method described in the lab handout 6. Observe the samples on increasing levels of magnification, starting with 10x and moving up to the oil objective
Start PCR Preparation for DNA Sequence Identification Procedure
1. Select a sample from each of the two groups that has the best characterization 2. Transfer a single colony of bacteria to 100 microliters of water in a sterile tube, then incubate at 100 degrees Celcius and centrifuge 3. Use 5 microliters of the supernatant in the PCR reaction
Raw Data
Table 1: 100-fold Serial Dilutions Results
See picture 4
Table 2: Colony Observations from Agar Plating
See Picture 5
Colony A-See Picture 1
Colony B-See Picture 3
Colony C-See Picture 2
Conclusions and Future Plans
The hay infusion culture smelled much more sour, lighter brown, with more of the debris settled on the bottom. The colonies with the antibiotic are much smaller than the colonies without the antibiotic; this indicates that bacteria have a harder time growing in the presence of antibiotic. Tetracycline decreases the total number of bacteria and fungi. There are not very many species of bacteria that are unaffected by tetracycline. Tetracycline does not kill bacteria; it just inhibits their ability to reproduce. It especially affects richettsia, spirochetes, and large viruses. The objectives were thoroughly met by this experiment.
BD
February 8, 2014
Introduction
The objectives of this experiment are to understand how to use a dichotomous key and to understand the characteristics of Algae and Protists. We will accomplish both of these objectives by identifying and characterizing two known organisms with a microscope and a dichotomous key along with six organisms from the hay culture.
Materials and Methods
How to Use a Dichotomous Key Procedure
1. Obtain a dichotomous key
2. Make a wet mount of one of the known samples
3. Focus on an organism: characterize and identify this organism using the dichotomous key
4. Repeat this procedure with a second known organism
Hay Infusion Culture Observations Procedure
1. Observe the culture inside of the jar and record observations
2. Observe a few samples from each area of the jar, identifying at least six organisms
3. Draw pictures of the organisms and measure their size along with recording observations
Preparing and Plating Serial Dilutions Procedure
1. Get four tubes of 10 mL sterile broth and label them 2,4,6,8
2. Get a micropipeter set at 100 microliters and pipette tips
3. Get four nutrient agar and four agar plus tetracycline plates
4. Label the tetracycline plates with “tet”
5. Label the plates from both groups 10-3, 10-5, 10-7, and 10-9
6. After swirling the hay infusion culture, take 100 microliters of the mixture and add it to the 10 mL of broth in the tube labeled 2
7. Take 100 microliters from tube 2 and inoculate tube 4 and swirl it to mix it well
8. Repeat for tube 3 and 4
9. Take 100 microliters from tube 2 and place it on the surface of the 10-3 nutrient agar plate; spread the sample on the plate
10. Repeat step nine for the rest of the plates
Figure 1: Serial Dilution Procedure
(See 1st Picture of Google Doc that I shared with you)
Raw Data
It was observed that the hay culture smelled very earthy, similar to dirt. It also smelled sort of stale. The dirt had settled to the bottom and the leaves had started to dissolve. It looked as if mold had settled on the top of the liquid, a sign of apparent life. The organisms removed from near the plant matter most likely photosynthesize, while the ones removed from an area away from the plant matter probably don’t photosynthesize. This is the same with the top of the culture compared to the bottom.
Known Organisms Observation Data
(See 2nd Picture of Google Doc I shared with you)
Hay Infusion Culture Observations Data
Organisms 1 (Colpidium sp.) and 2 (Gonium): Obtained from the top of the culture
1: green, mobile, pretty quick, round, 50 micrometers on 10x
2: mobile, spinning quick, many green dots, 75 micrometers on 10x
(See 3rd Picture on Google Doc)
Organisms 3 (Colpidium) and 4 (Arcella): Obtained from near a leaf
3:colorless with green dots, round, mobile, 30 micrometers on 10x
4: barely mobile, round, 30 micrometers on 10x
(See 4th Picture)
Organisms 5 (Euglena) and 6 (Didinium): Obtained from the bottom of the culture
5: mobile, round, green, sporadic movement, 60 micrometers on 10x
6: mobile, spinning, could be the same as gonium but different motion, 80 micrometers on 10x
(See 5th Picture)
Gonium grow asexually, and multiply by multiple-fission. They are a product of evolution, evolving from Chlamydomonas. Gonium are unicellular but usually exist in multicellular colonies.
Link to Images:
Conclusions and Future Plans
If the hay infusion culture would have been observed for another two months, I would predict that much less life would be observed in the culture. This is because the living organisms would be subjected to artificial conditions for even longer than they already have. One major selective pressure that affected the composition of the samples is that there is a much smaller source of food for the living organisms now since they are confined to a jar. Also, they are now in much more liquid since they were placed in water and milk. One set of results that stood out in particular is the identification of organisms 2 and 6 from our hay infusion culture; they were very similar in appearance but 2 exhibited much more movement. The objectives of understanding how to use a dichotomous key and understanding the characteristics of Algaue and Protists were met in this experiment.
BD
2/6/14, lab 1 notes
Great characterization!! Try making a table next time instead of using text (for your table 1) using the tricks we talked about in lab this week. Great job!
AP
January 30, 2014
Introduction
The objectives of this experiment are to understand natural selection and to understand the biotic and abiotic characteristics of a niche. We will understand the process of natural selection by viewing samples of green algae with a microscope and considering the selective pressures that have affected the Volvocine line. Also, we will better understand biotic and abiotic factors in a niche by observing and recording these factors in a particular transect of AU’s campus that is assigned to our groups.
Materials and Methods
The Volvocine Line Procedure 1. Prepare a wet mount of living Chlamydomonas and examine it with a microscope 2. Locate different structures such as the pyrenoid, stigma, conspicuous chloroplast, and flagella 3. Observe a culture of Gonium 4. Observe a Volvox colony 5. Complete Table 1 with the observations made from viewing the different types of green algae
Defining a Niche at AU Procedure 1. Obtain the transect assignment from the TA 2. Get a 50 mL sterile conical tube to collect a sample 3. Observe the transect, recording its characteristics and biotic and abiotic factors 4. Use the sterile conical tube to obtain a soil and vegetation sample of the transect 5. Return to the lab and weigh 10-12 grams of the sample and put it in a clear plastic jar with 500 mLs of water 6. Add .1 gm dried milk and mix for around 10 seconds 7. Remove the lid and place the jar in the designated area in the lab 8. Label the jar so the group will be able to identify it at a later time
Raw Data
Table 1: Evolutionary Specialization of Members of the Volvocine Line Characteristic Chlamydomonas Gonium Volvox Number of Cells 32-unicellular 3-multicellular 75-multicellular Colony Size 10 micrometers 32.5 micrometers 187.5 micrometers Describe any functional specialization of cells Very motile,Large vacuole,Cell Membrane-Chlamydomonas Cell Membrane,Membrane-bound organelles-Gonium Vacuole, Cell Membrane-Volvox Describe any reproductive specialization (isogamy vs. oogamy) Isogamy-Chlamydomonas Oogamy-Gonium Oogamy-Volvox
Cell specialization across these three genera allow for survival. Since Chlamydomonas live in damp soil, lakes, and ditches, it is important for them to be able to move in order to perform functions necessary for life. Evolution does not always move towards increased complexity. Evolution will select structures that are beneficial to a species, so if they are not using a particular part, then it will be selected against. An example of this is the tailbone in humans.
Transect Niche
Our group’s transect is a leaf bed on the side of a hill right next to the Wesley Theological Seminary down Massachusetts Avenue. The slanted surface forces rain and things of the sort to run down into the transect. There are two biotic factors in the Holly tree and Pine tree in the transect. The fallen pine leaves act as a fertilizer for the other plant life in the transect, and are an abiotic factor. There is also a dead sycamore tree, an abiotic factor. Its roots also act as a fertilizer in the transect. The bed of leaves that makes up the majority of the transect is a biotic factor. Layers of vegetation have accumulated over time one the ground. The Wesley Seminary and the picnic tables nearby are not necessarily in the transect but they might be considered abiotic factors since they attract humans which could lead to trash being thrown in the transect or the animals in the transect being disturbed. A very important abiotic factor, the sun, is blocked by the trees that reduce the amount of sun the vegetation on the ground receives. The transect was observed a few days later after it had snowed, and animal tracks were identified near the base of the trees. They looked like a squirrel might have made them.
Conclusions and Future Plans
This transect will be very interesting to observe over the course of the semester due to its close proximity to the seminary, its downhill location, and its abundance of vegetation. It will also be interesting to see how the trees and vegetation interact with the animals in the transect. It can be concluded from the first part of the experiment that colonies of Volvox are generally the largest of the Volvocine line, while Chlamydomonas colonies are the smallest. Future studies for this experiment can and will include observation of the transect and the hay infusion culture. The objectives of understanding natural selection and biotic and abiotic characteristics of a niche were met in this experiment.
BD
