User:Alji

Andrew Ji

About Me

• Year: 2009
• Major: Biological Engineering
• Minor: Economics
• Email: alji AT mit DOT edu

M13K07 Genome Re-engineering ideas:

Gene	Ideas
I	Change size of protein to see effect of different channel sizes.
II	Increase or decrease expression to optimize rate of + strand replication.
III	Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host.
IV	Change size of protein to see effect of different channel sizes.
V	Add more DNA binding sites to see if more DNA can be packaged into phage.
VI	Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host.
VII	Tag protein to monitor interaction with p5/DNA complex.
VIII	Change size of protein to experiment with the size of coat.
IX	Tag protein to monitor interaction with p5/DNA complex.
X	Increase expression to see if more phage leave the host E. coli.
XI	Change size of protein to see effect of different channel sizes.

M13 Refactoring

I attempted to refactor the M13K07 phage by removing the overlapping areas of genes between the HpaI site of gene 2 and the BamHI site of gene 3. I did this by duplicating each gene (promoter, rbs, and ORF) and placing it after the ORF of the previous gene. I mutated the RBS's of each overlapping area to a silent mutation to prevent readout of the overlapping sections. There were 6 places of overlap, and I have included what changes I made. As a result, I have added 769 bp to the original section of DNA. In between each gene, I left 11 extra base pairs in order to introduce restriction sites so that each part can be manipulated individually. I want to see what others have done before attempting to introduce new restriction endonuclease sites.

Overlapping Areas	Original Sequence	Modified sequence
Gene 2 ORF and Gene 10 RBS	At bp 478: gcatttgag	gcGtttgag
Gene 2 ORF and Gene 5 RBS	At bp 826: gcataaggt	gcGtaaggt
Gene 10 ORF and Gene 5 RBS	At bp 1286: gcataaggt	gcGtaaggt
Gene 5 ORF and Gene 7 RBS	At bp 1609: gttccggct	gtCccggct
Gene 7 ORF and Gene 9 RBS	At bp 1733: cgctggggg	cgAtggggg
Gene 9 ORF and Gene 8 RBS	At bp 1869: aatggaaac	aaCggaaac

The refactored genome is Part BBa_M31332 on the Registry of Standard Biological Parts

SAGA subunits, S. cerevisiae

Ada subunits	size,chromosome,null p-type	notes
Ada1 (aka HFI1, SUP110, SRM12, GAN1)	1.467 kb/489 aa, Chr. XVI, viable
Ada2 (aka SWI8)	1.305 kb/434aa, Chr. IV, viable
Ada3(aka NGG1, SWI7)	2.109 kb/702aa, Chr. IV, viable
Gcn5 (aka ADA4, SWI9)	1.32 kb/439aa, Chr. VII, viable
Ada5 (aka SPT20)	1.815 kb/604aa, Chr. XV, viable

Spt subunits	size, chromosome, null p-type	notes
Spt3	1.014 kb/337aa, Chr. IV, viable
Spt7(aka GIT2)	3.999 kb/1332aa, Chr. II, viable
Spt8	1.809 kb/602aa, Chr. XII, viable
Spt20 (aka Ada5)	1.815 kb/604aa, Chr. XV, viable

TAF subunits	size, chromosome, null p-type	notes
TAF5 (aka TAF90)	2.397 kb/798aa, Chr. II, inviable
TAF6 (aka TAF60)	1.551 kb/516aa, Chr. VII, inviable
TAF9 (aka TAF17)	0.474 kb/157aa, Chr. XIII, inviable
TAF10 (aka TAF23, TAF25)	0.621 kb/206aa, Chr. IV, inviable
TAF12(aka TAF61, TAF68)	1.620 kb/539aa, Chr. IV, inviable

Tra1 subunit	size, chromosome, null p-type	notes
Tra1	11.235 kb/3744aa, Chr. VIII, inviable

other subunits	size, chromosome, null p-type	notes
Sgf73	1.974 kb/657aa, Chr. VII , viable
Sgf29	0.779 kb/259aa, Chr. III, viable
Sgf11	0.3 kb/99aa, Chr.XVI, viable
Ubp8	1.416 kb/471aa, Chr. XIII, viable
Sus1	gene with intron, Chr. II, viable

Primer	Primer Number	Sequence	Anneals
URA3 replacement PCR Forward Primer	NO177	5' GCGACAAAATCAGAAGTAACAATTCTGGCCTTCACTCCAatgtcgaaagctacatataa	20 bp upstream of SUS1
URA3 replacement PCR Reverse Primer	NO178	5' TGTAATAATATTGGGAATTAAGGTGCATTTTCGTATCCTttagttttgctggccgcatc	20 bp downstream of SUS1
Colony PCR Forward Primer	NO193	5' AATGGTTAAGATACCAATGCCGTCTACACC	520 bp upstream of SUS1
Colony PCR Reverse Primer	NO179	5' CTGTGCCCTCCATGGAAAAATCAGTCAAGA	191-220 bp (btm strand) after URA3 ATG

Media	Temperature
YP Galactose	23 C
YP Galactose	30 C
YP Galactose	37 C
YP Dextrose	23 C
YP Dextrose	30 C
YP Dextrose	37 C
YP+Rapamycin	30 C
YP-Lysine	30 C
YP	30 C
YP-Tryptophan	30 C

Transformation	Number of Colonies
"Plus template"	10
"No template"	3
50 ng pRS406 DNA	800

	Surface display of scFv fusion?		Binding to gold?
	Glucose	Galactose	Glucose	Galactose
pCT-CON	N	Y	N	Y
pAu1	N	Y	N	Y

Transformation	Number of Colonies
pCT-CON	2
Peptide library	3
pAu1	1944

Plasmid	Altered Condition	Number of Colonies
pCT-CON	45-min. panning	0
pAu1	45-min. panning	0
pCT-CON	2X BSA	0
pAu1	2X BSA	0