The BioBricks Foundation:BBFRFC12

        BBF RFC-12 Draft Standard for Biobrick BB-2 Biological Parts

                              Tom Knight
                           19 November 2008

This standard defines the required sequence properties for a
Biobrick(R) BB-2 standard biological part.  It does not define any
functional characteristics of the parts, nor does it motivate any
aspect of these standards.  All sequences defined herein are specified
in the 5' to 3' direction.

0. A Biobrick BB-2 compatible standard biological part consists of a DNA
   fragment potentially conveying informational or functional
   properties to a composite structure assembled from multiple parts.
   The current assembly process requires certain sequence properties
   for the part and the surrounding DNA.


1. Allowed sequences within Biobrick BB-2 parts include any DNA sequence
   which does not contain the following subsequences:

   EcoRI site:   GAATTC
   SpeI site:    ACTAGT
   NheI site,    GCTAGC
   PstI site:    CTGCAG
   NotI site:    GCGGCCGC

   Additionally, there are a set of sites which, if convenient, should
   also be eliminated.  Parts containing these sites qualify as fully
   Biobrick BB-2 standard compliant, but future assumbly and advanced uses
   of the parts may be compromised.  These include:

   PvuII site:   CAGCTG
   XhoI site;    CTCGAG
   AvrII site:   CCTAGG
   XbaI site:    TCTAGA
   SapI site:    GCTCTTC and GAAGAGC

2. Biobrick BB-2 Suffix

   Each Biobrick BB-2 part must contain precisely this sequence immediately
   following the 3' end of the part:

   GCTAGC GCGGCCG CTGCAG
   (note: if constructing a primer, this sequence must be reverse
   complemented.)

3. Biobrick BB-2 Prefix:

   Each Biobrick BB-2 part must contain precisely the following
   sequence immediately 5' of the part:

   GAATTC GCGGCCGC ACTAGT

4. Plasmid context

   Biobrick BB-2 parts must be supplied in plasmids compatible with
   registry and assembly procedures.  The pS2Bxxxx series of plasmids
   comply with these requirements.  Other plasmids may be compliant
   with the following constraints:

   a. Antibiotic resistance:

      All plasmids must carry at least one of the following antibiotic
      resistance markers:

      Ampicillin
      Chloramphenicol
      Kanamycin
      Tetracycline

      It is acceptable for a plasmid to convey both ampicillin
      resistance and no more than one additional antibiotic resistance
      markers.

      Note that certain strains convey resistance as well.  Parts
      delivered to the registry must be in strains which do not convey
      resistance to these markers.


   b. Sequencing primers

      The registry uses the following primers in sequencing all parts.
      Plasmids which omit or misplace these primers cannot be
      sequenced:

      VF2:  TGCCACCTGACGTCTAAGAA
      VR:   ATTACCGCCTTTGAGTGAGC


5. Strains

   The registry maintains parts libraries in frozen bacterial
   cultures, and encourages submissions in this form.  The bacterial
   strain must be a K-12 cloning strain (endA-).  Under no
   circumstances will the registry accept submissions in any strain
   which is not BSL-1.  We recommend strains such as Top10, DH10B, and
   DH5a.  We do not recommend submissions in MC4100, BL21 and similar
   strains.


6. PCR contruction of Biobrick parts

   Biobrick BB-2 parts can be constructed by PCR from naturally occurring
   coding regions or other long DNA sequences.  The recommended primer
   sequences for PCR of these fragments are:

   Biobrick BB-2 PCR prefix:
   GTTTCTTC GAATTC GCGGCCGC ACTAGA <18-24 bp of matching primer>

   Biobrick BB-2 PCR suffix:
   GTTTCTTC CTGCAG CGGCCGC GCTAGC <18-24 bp of matching primer (reverse complement).

   The reverse complement of this suffix sequence is:
   GCTAGC  GCGGCCG CTGCAG GAAGAAAC
   This the forward sequence at the end of the PCR product


7. Assembly Scar

   The assembly scar left with standard BB-2 assembly is the six base sequence GCTAGT.
   As codons, this translates (in frame) in the universal code as Ala-Ser.

------------
Biobrick(R) is a registered trademark of the Biobricks Foundation, Inc.