Template:SBB12 part sbb1220

From OpenWetWare
Jump to navigationJump to search
Partname:     sbb1220
Description:  P_R-CmR
Genename:     P_R, CmR
Source:       Lambda phage / synthetic

You are going to make a CmR reporter of the P_R promoter from lambda phage. This promoter shuts down when bound to CI protein. CmR confers chloramphenicol resistance when expressed, and it can also be assayed biochemically. The sequence of the P_R part, which is present in pBjk2741-jtk2801 is:

 GATCTtaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcG

You can get the rbs.CmR part from plasmid pKGC438. What you want to make is a BglBrick part that would result from joining the P_R part with the rbs.CmR part. In designing this, you'll need to make arbitrary decisions about where to 'cut' the non-BioBrick pKGC438 sequence. I would recommend starting from the CCAC... after the T7 promoter and then ending after the stop codon. Though the final construct should be a BglBrick part, you'll be making the construct by SOEing. In designing your construction file for this, note that the P_R part is really short, and things will go better if you use oligo ca998 as the forward external oligo instead of some annealing region that binds within the part. Ask JCA if that doesn't make sense.

The vector for your final product should be pBgl00001, and you can use plasmid pBgl00001-Bjk2828. Note that this plasmid has a p15A origin of replication, and as such is much lower copy than most other parts you'll work with. As a result, you won't get much material in your minipreps, and you should adjust things accordingly.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.


Construction File

PCR ca998/gfRevPR on pBjk2741-jtk2801	    	(160bp, A)
PCR gfForRbsCmR/gfRevRbsCmR on pKGC438    	(920bp, B)
PCR ca998/gfRevRbsCmR on A+B         		(1059bp, pcrpdt)
Digest pcrpdt                    		(EcoRI/BamHI, L, pcrdig)
Digest pBgl00001-Bjk2828         		(EcoRI/BamHI, L, plasdig)
Ligate pcrdig and plasdig, product is pBgl00001-sbb1220
----
>ca998	Forward external annealing for purification of P_R part
gtatcacgaggcagaatttcag
>gfForRbsCmR
ggtgataatggttgcGGATCTCCACAACGGTTTCCCTC
>gfRevRbsCmR
gctagGGATCCTTACGCCCCGCCCTGCCAC
>gfRevPR
AGATCCgcaaccattatcacc
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATCTGAAGTGGAATTCATGAGATCTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCGGATCTCCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGAGCGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACGATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAGGATCCCTAGC