Template:SBB12Project stdt1213

From OpenWetWare
Jump to navigationJump to search

Your name here

Welcome to your project page!

I've given you two parts to make.

  • Design oligos to make your part
  • Write up a proper construction file on the wiki template associated with your part
  • Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.

Finally, you should create a notebook on the on the main class page of the wiki


Partname:     sbb1222
Featurename:  PhoA
Genename:     phoA
Source:       Escherichia coli

Encodes alkaline phosphatase, a reporter of periplasmic expression. Though not a homodimer, you should treat it as such during construction. Your product will help verify that ToxR is being expressed in the inner membrane. The source of your feature is plasmid pBjh1601CK-Bjh2128

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCR phoA-F/phoA-R on pBjh1601CK-Bjh2128  (1225 bp, pcrpdt)
Digest pcrpdt                            (NheI/BamHI, L, pcrdig)
Digest pBca9525-Bca1834                  (NheI/BamHI, L, vectdig)
Ligate pcrdig and vectdig (pBca9525-sbb1222)
-------------------------------
>phoA-F Forward oligo for cloning of phoA
ctcggGCTAGCGGCAGTGGATCTGGTggagattctgaaataaccgc
>phoA-R Reverse oligo for cloning of phoA
gcaaaGGATCCcttcaggcccagcgccgctt
>pcrpdt
CTCGGGCTAGCGGCAGTGGATCTGGTGGAGATTCTGAAATAACCGCCGCACGAAATTATGCCGAAGGCGCCGGCGGCTTTTTTAAAGGTATTGATGCCCTGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCGCGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTACAGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCGATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGGGATCCTTTGC


Partname:     sbb1211
Featurename:  lz_AAAA
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCA1 on o1,o11,o2         (pca1)
PCA2 with o1/o2 on pca1   (142 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1211dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1211dig + vectdig, product is pBca9525-sbb1211
----
>o1	
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGT
>o2	
CAGTAGGATCCTTAGCAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>o11
CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTGCTAAGGATCCTACTG