Template:SBB12Project stdt1210

Daniel Chao
Your part uses pBgl00001-Bjk2828 as its vector.... You need a special antibiotic.

Welcome to your project page!

I've given you two parts to make.

• Design oligos to make your part
• Write up a proper construction file on the wiki template associated with your part
• Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.

Finally, you should create a notebook on the on the main class page of the wiki

Partname:     sbb1221
Description:  P_R-Bla
Genename:     P_R, Bla
Source:       Lambda phage / synthetic

You are going to make a Bla reporter of the P_R promoter from lambda phage. This promoter shuts down when bound to CI protein. Bla confers ampicillin resistance when expressed, and it can also be assayed biochemically. The sequence of the P_R part, which is present in pBjk2741-jtk2801 is:

 GATCTtaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcG

You can get the rbs.Bla part from plasmid pBgl00001-Brp0006. What you want to make is a BglBrick part that would result from joining the P_R part with the rbs.Bla part. However, you'll be making the construct by SOEing. In designing your construction file for this, note that the P_R part is really short, and things will go better if you use oligo ca998 as the forward external oligo instead of some annealing region that binds within the part. Ask JCA if that doesn't make sense.

The vector for your final product should be pBgl00001, and you can use plasmid pBgl00001-Bjk2828. Note that this plasmid has a p15A origin of replication, and as such is much lower copy than most other parts you'll work with. As a result, you won't get much material in your minipreps, and you should adjust things accordingly.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

Construction File

PCR ca998/gfRevPR on pBjk2741-jtk2801	    	(160bp, A)
PCR dc5002/g00101 on pBgl00001-Brp0006    	(1100bp, B)
PCR ca998/g00101 on A+B         		(1236bp, pcrpdt)
Digest pcrpdt                    		(EcoRI/BamHI, L, pcrdig)
Digest pBgl00001-Bjk2828         		(EcoRI/BamHI, L, plasdig)
Ligate pcrdig and plasdig, product is pBgl00001-sbb1221
----
>ca998	Forward external annealing for purification of P_R part
gtatcacgaggcagaatttcag
>dc5002 Forward PCR of rbs.Bla
ggcggtgataatggttgcGGATCTtacgacgggAAGC
>gfRevPR
AGATCCgcaaccattatcacc
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATCTGAAGTGGAATTCATGAGATCTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCGGATCTTACGACGGGAAGCTTAAATCCTAATGGTTTATTTTGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTGGATCCTAACTCGCTCCTCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT

Partname:     sbb1228
Featurename:  [AS]4
Genename:     n/a
Source:       Synthetic

The simple peptide ASASASAS*

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.

Construction File

Wobble dc5003/dc5004           (64bp, wobpdt)
Digest wobpdt                  (NheI/BamHI, L, wobdig)
Digest pBca9525-Bca1839        (NheI/BamHI, L, vectdig)
Ligate wobdig + vectdig        (pBca9525-sbb1228)
----
>dc5003   Forward construction of AS repeat and linker
CCATAgctagcGGCAGTGGATCTGGTGCTTCTGCTTCTGCT
>dc5004   Reverse construction of AS repeat and linker
CTGATGGATCCTTAAGAAGCAGAAGCAGAAGCAGAAGCACCAG
>wobpdt
CCATAgctagcGGCAGTGGATCTGGTGCTTCTGCTTCTGCTTCTGCTTCTTAAGGATCCATCAG