Template:SBB10 ConstructionFiles ZhenH sbb31

From OpenWetWare
Jump to: navigation, search
sbb31: CA42 origin of replication
Source:  pEC22-CA42
Target Sequence:  agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg
Vector:  pBjk2741
Short description: oriCA42
Genbank reference: D30056.1 
Family:  Origin of Replication

PCR ZZH001 and ZZH002 on pEC22-CA42  (547 bp, EcoRI/BamHI)
Sub into pBca9523-Bca1144            (EcoRI/BamHI, 2472+910, L)
Product is pBca9523-sbb31         {oriCA42}
ZZH001   Forward oligo for cloning of oriCA42   
ZZh002   Reverse oligo for cloning of oriCA42    

JCA Notes

  • Correct, except should clone into pBjk2741-Bca1144
PCR ZZH001 and ZZH002 on pEC22-CA42  (547 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144            (EcoRI/BamHI, 2472+910, L)
Product is pBjk2741-sbb31         {oriCA42}
ZZH001   Forward oligo for cloning of oriCA42   
ZZh002   Reverse oligo for cloning of oriCA42    