Template:SBB10 ConstructionFiles ZhenH sbb15
From OpenWetWare
Jump to navigationJump to search
sbb15: phiC31 attB
Source: Synthetic
Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector: pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842)
Family: Phage att site
good 20 bp gtgccagggcgtgcccttgg
Wobble ZZH003/ZZH004 (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15 {phiC31 attB}
----
ZZH003 Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004 Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac
JCA Notes
- Correct