Template:SBB10 ConstructionFiles ZhenH sbb15

From OpenWetWare
Jump to navigationJump to search
sbb15: phiC31 attB
Source:  Synthetic
Target Sequence:  tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector:  pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842) 
Family:  Phage att site

good 20 bp gtgccagggcgtgcccttgg

Wobble ZZH003/ZZH004            (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144         (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15     {phiC31 attB}
----
ZZH003   Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004   Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac

JCA Notes

  • Correct