Template:SBB10 ConstructionFiles ZhenH sbb15
From OpenWetWare
Jump to navigationJump to search
sbb15: phiC31 attB Source: Synthetic Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca Vector: pBjk2741 Short descriptions: phiC31 attB Genbank reference: AB306970 (759…842) Family: Phage att site good 20 bp gtgccagggcgtgcccttgg Wobble ZZH003/ZZH004 (115bp, EcoRI/BamHI) Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2170+910, L) Product is pBjk2741-sbb15 {phiC31 attB} ---- ZZH003 Forward construction of phiC31 attB basic part ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg ZZH004 Reverse construction of phiC31 attB basic part ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac
JCA Notes
- Correct