Template:SBB10Project-27095
Kai Mesa's Project
sbb27: CA42 rep Protein
Source: pEC22-CA42
Target Sequence: cccggagagaatcgtaacacatgagcgccgcgcttcaatacttcgacgaaaatttaccccatcgtccctatcacacggatgatctcgcttttggtcttcgcatctccggcaaagggcgtgcgcttcttgcgcggtacatacagcagaaccagcctcatgcgcagttctggctggtttttgatgttgaccgcgagggggctgcgattgactggagcgacctgaacgcccccgcaccgaacatcaccataaaaaatcccgtgaacggtcacgcccacctgctctacgcactcaatatcgccgtgagaaccgcgcctgatgcttcggttaaggcactgaaatacgccgccgcgattgaacgtgcgttgtgtgaaaaactgggcgcagatgtaaactacagcggcctgatttgcaaaaatccgttccatctggaatggcaggtgatggagtggcgtgaggaagcctataccctcgatgaactggctgattatcttgatttgagcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatag
Vector: pBca9523
Short description: rbs_repCA42!
Genbank reference: D30056.1
Flavor: {rbs.part!}
Family: Replication protein
This part encodes a replication protein
Replication proteins are, well, proteins involved in replication. Most of the ones involved in this project are DNA binding proteins of sorts that bind to a specific DNA cis element and initiate replication in cis. In other words, they replicate the DNA that contains the cis element.
Different replication protein coding parts are needed in different flavors, so take special note of what type this one should be. Replication proteins are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.
This part is associated with colE2 orthogonal replicon devices
The colE2 family of replicons encode two elements to enable replication of a circular DNA in E. coli: one is a protein called Rep and the other is a cis element, or more specifically the origin of replication, or just ori. Placing the ori in cis and a complete gene for producing Rep either in cis or in trans should allow replication of the DNA containing ori.
The purpose for these devices is to make additional conditional replicons that can be used in the same cell in E. coli. Ultimately, these will drive replication of the delivered DNAs in our systems allowing them to be cranked up to really high-copy in the cell. Our "Entry Vector" for this project, pBjk274, incidentally, replicates with a colE2-derived replicon. So, take special note of the instructions below as to which plasmid you should use for constructing your basic part.
You should read the following papers
References: PMID 17098894, PMID 8609624, and PMID 2841566.
sbb16: phiC31 attP
Source: Synthetic Target Sequence: agaagcggttttcgggagtagtgccccaactggggtaacctttgagttctctcagttgggggcgtagggtcgccgacatgacac Vector: pBjk2741 Short description: phiC31 attP Genbank reference: X57036 (1598…1681) Family: Phage att site
This part encodes a DNA cis element
DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.
This part is associated with phiC31 integration devices
phiC31 is a bacteriophage integrase. It is somewhat similar in mechanism to Cre recombinase, but it acts on the asymmetric sites attB and attP. It causes these sequences to be recombined to generate attL and attR sequences. This system is useful for integrating large DNAs site-specifically into genomes.
You should read the following papers
References: PMID 14996222, PMID 19002165, PMID 19439387, PMID 12034816
