Template:SBB10Project-19607

From OpenWetWare
Jump to navigationJump to search

Paulina Tran

Error creating thumbnail: File missing

Welcome to your project page!

For each part listed, you should:

  • Design oligos to make your part
  • Write up proper construction files and put it on the Construction Files page
  • Put your oligos on the Oligo Log page
  • Put your parts into Clotho

You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.

Several references have been provided to give you some background on the biology of your part.

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.

Finally, you should create a notebook on the main page of the wiki

sbb21: FokI Cleavage Domain (fok+)

 Source:  Registry part BBa_K243000 in vector BBa_K157000
 Target Sequence:  CAGCTGGTTaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatTgcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttt
 Vector:  pBjk2741
 Short description: <FokI+>
 Flavor:  {<part>} 
 Family:  Restriction Endonuclease

Your part exists in the Registry of standard biological parts, but this template sequence differs from what you want by 1 mutation and 3 extra AA at N-term. Take careful note in designing your oligos that you generate the correct product.

This part encodes a DNA modifying enzyme

Different DNA modification enzymes are needed in different flavors, so take special note of what type this one should be. DNA modification enzymes are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.

This part is associated with Zinc Finger Nuclease devices

A zinc finger nuclease is an engineered protein derived from two zinc finger DNA binding proteins and cutting domains usually from a type IIS restriciton enzyme. The special thing about them is that 1) they bind long sequences of DNA, long enough that it might be unique in a eukaryotic genome, and 2) zinc finger proteins that bind to most sequences can be generated somewhat easily. So, you can use a zinc finger nuclease to introduce a ds break at a specific user-defined site in a eukaryotic genome if the protein is delivered to the nucleus of the cell. Eukaryotic ds breaks stimulate homologous recombination. So, if you deliver both the ZFN and a DNA homologous to the target site, you get insertion of your DNA into that site of the genome.

You should read the following papers
References: PMID 18545224, PMID 17603475, PMID 11821858


sbb08: Tn5 5'TR

 Source:  Synthetic
 Target Sequence:  GTCGACTGTCTCTTATACACATCTCAACC
 Vector:  pBjk2741
 Short description: Tn5 5'TR  
 Family:  Terminal Repeat

This part encodes a DNA cis element

DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.

This part is associated with Tn5 transposon devices

Tn5 transposase is a popular enzyme that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome). Unlike Sleeping Beauty and piggyBac which comes from eukaryotic organisms, Tn5 comes from enterobacterial tranposons.

You should read the following papers
References: PMID 12189420, PMID 16079303, PMID 18805998