Template:SBB10Project-19329

From OpenWetWare
Jump to navigationJump to search

Raffi Hagopian

Error creating thumbnail: File missing

Welcome to your project page!

For each part listed, you should:

  • Design oligos to make your part
  • Write up proper construction files and put it on the Construction Files page
  • Put your oligos on the Oligo Log page
  • Put your parts into Clotho

You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.

Several references have been provided to give you some background on the biology of your part.

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.

Finally, you should create a notebook on the main page of the wiki

sbb09: Tn5 3'TR

 Source:  Synthetic
 Target Sequence:  GGTTGAGATGTGTATAAGAGACAGTCGAC
 Vector:  pBjk2741
 Short description: Tn5 3'TR  
 Family:  Terminal Repeat

This part encodes a DNA cis element

DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.

This part is associated with Tn5 transposon devices

Tn5 transposase is a popular enzyme that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome). Unlike Sleeping Beauty and piggyBac which comes from eukaryotic organisms, Tn5 comes from enterobacterial tranposons.

You should read the following papers
References: PMID 12189420, PMID 16079303, PMID 18805998

sbb33: Gentamicin resistance gene

 Source:  pLoxGen4
 Target Sequence:  ctagcgcgtcggccgggaagccgatctcggcttgaacgaattgttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccgtatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctgcttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgaggagattgatgagcgcggtggcaatgccctgcctccggtgctcgccggagactgcgagatcatagatatagatctcactacgcggctgctcaaacctgggcagaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagcaagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagccacctaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgcttggatgcccgaggcatagactgtacaaaaaaacagtcataacaagccatgaaaaccgccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgagcgcatacgctacttgcattacagtttacgaaccgaacaggcttatgtcgacgcgctag
 Vector:  pBjk2741
 Short description: Promoter.rbs.GenR
 Genbank reference: AJ401048 (793…1594) 
 Family:  Antibiotic Resistance Gene

This part encodes an antibiotic marker

Antibiotic resistance proteins confer resistance to some specific, toxic small molecule. This part is a composite part containing a complete promoter.rbs.cds.term composite part. So, when you introduce it into the cell it should confer resistance to the cognate antibiotic.

Complete genes are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies. When building your part, you should plate twice. On one plate, use just the antibiotic associated with your vector (usually spectinomycin). On a second plate, use both the vector antibiotic and the antibiotic associated with this part. Note how many colonies are observed on the plates in your notebook.

This part encodes a complete gene composite part

Sometimes we make basic parts contain more than just a primitive element if there is reason to believe that some natural non-biobrick composition might be important for its activity. This is one of those instances. The part encodes a native promoter, rbs, coding sequence, and terminator -- a complete gene.

Parts containing transcriptionally-competent constructs are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.