Template:SBB10Project-15954

From OpenWetWare
Jump to navigationJump to search

Andrew Saarni

Error creating thumbnail: File missing

Welcome to your project page!

For each part listed, you should:

  • Design oligos to make your part
  • Write up proper construction files and put it on the Construction Files page
  • Put your oligos on the Oligo Log page
  • Put your parts into Clotho

You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.

Several references have been provided to give you some background on the biology of your part.

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.

Finally, you should create a notebook on the main page of the wiki

sbb12: sleeping beauty 3'TR

 Source:  Synthetic
 Target Sequence:  ttgagtgtatgttaacttctgacccactgggaatgtgatgaaagaaataaaagctgaaatgaatcattctctctactattattctgatatttcacattcttaaaataaagtggtgatcctaactgaccttaagacagggaatctttactcggattaaatgtcaggaattgtgaaaaagtgagtttaatgtatttggctaaggtgtatgtaaacttccgacttcaactg
 Vector:  pBjk2741
 Short description: sleeping beauty 3'TR  
 Family:  Terminal Repeat

This part encodes a DNA cis element

DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.

This part is associated with sleeping beauty transposon devices

Sleeping Beauty transposase is a popular enzyme that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome).

You should read the following papers
References: DOI 10.1007/s10989-007-9114-z, PMID 19412179

This part requires Gene Synthesis

To make this part, you'll use gene synthesis. You may use the tools at GeneDesign to design your oligos for making this part by the PCA method. The protocol is here.

sbb14: PhiC31 Integrase

 Source:  pBca9523-Bca1623, pBca9523-Bca1659
 Target Sequence:  MDTYAGAYDRQSRERENSSAASPATQRSANEDKAADLQREVERDGGRFRFVGHFSEAPGTSAFGTAERPEFERILNECRAGRLNMIIVYDVSRFSRLKVMDAIPIVSELLALGVTIVSTQEGVFRQGNVMDLIHLIMRLDASHKESSLKSAKILDTKNLQRELGGYVGGKAPYGFELVSETKEITRNGRMVNVVINKLAHSTTPLTGPFEFEPDVIRWWWREIKTHKHLPFKPGSQAAIHPGSITGLCKRMDADAVPTRGETIGKKTASSAWDPATVMRILRDPRIAGFAAEVIYKKKPDGTPTTKIEGYRIQRDPITLRPVELDCGPIIEPAEWYELQAWLDGRGRGKGLSRGQAILSAMDKLYCECGAVMTSKRGEESIKDSYRCRRRKVVDPSAPGQHEGTCNVSMAALDKFVAERIFNKIRHAEGDEETLALLWEAARRFGKLTEAPEKSGERANLVAERADALNALEELYEDRAAGAYDGPVGRKHFRKQQAALTLRQQGAEERLAELEAAEAPKLPLDQWFPEDADADPTGPKSWWGRASVDDKRVFVGLFVDKIVVTKSTTGRGQGTPIEKRASITWAKPPTDDDEDDAQDGTEDVAA
 Vector:  pBjk2741
 Short description: rbs.phiC31>
 Genbank reference: X59938.1
 Flavor:  {rbs.part>} 
 Family:  Phage Integrase

A template for making this part has been constructed as two synthons in plasmids pBca9523-Bca1623 and pBca9523-Bca1659. You will need to use SOEing to splice these two synthons together. Take special note that you are creating the correct flavor for this part. You'll need to generate a strong RBS for this part.

This part encodes a DNA modifying enzyme

Different DNA modification enzymes are needed in different flavors, so take special note of what type this one should be. DNA modification enzymes are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.

This part is associated with phiC31 integration devices

phiC31 is a bacteriophage integrase. It is somewhat similar in mechanism to Cre recombinase, but it acts on the asymmetric sites attB and attP. It causes these sequences to be recombined to generate attL and attR sequences. This system is useful for integrating large DNAs site-specifically into genomes.

You should read the following papers
References: PMID 14996222, PMID 19002165, PMID 19439387, PMID 12034816

This part requires the RBS Calculator

Your part includes a ribosome binding site in it. We want to maximize expression of this part, so we want a strong one. Go to http://voigtlab.ucsf.edu/software/. To generate an RBS, paste the DNA sequence for your part from start codon on into the box saying "Protein Coding Sequence." In the "Pre-Sequence" box, put in "GGATCT". In the Target Translation Initiation Rate box put "100000" (100000 is the highest expression level). Then submit it. You'll get an email with an RBS sequence that you can incorporate into your part. Your pre-sequence "GGATCT" should be replaced with BglII restriction site.